Details of 2011 Reference Sequence Update

The S. cerevisiae strain S288C reference genome sequence was updated in its first major complete update since 1996. The new genome sequence (R64.1.1, 2011-02-03) was compared to the previous version (R63.1.1, 2010-01-05) and corrected accordingly. The sequences of all 16 nuclear chromosomes were updated, resulting in amino acid sequence changes to the 194 proteins listed below. Note that in addition to these, silent changes were made in 42 ORFs. For more information and a complete set of sequence changes, please see:

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) Mar 20;4(3):389-98.
SGD Paper | PubMed | Full-Text

ORFDescription of change
MDM10/YAL010CNucleotide change(s) in the coding region of MDM10/YAL010C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 272 is now Asparagine rather than Glutamine.
             ||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||
DEP1/YAL013WTwo nucleotides were deleted near the 3' end of ORF DEP1/YAL013W, altering its coding sequence.The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 15 amino acids shorter.
          |||||||||||||||||  ||||||||||||||||||||||||| 
PSK1/YAL017WNucleotide change(s) in the coding region of PSK1/YAL017W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 73 is now Glutamic Acid rather than Glutamine.
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
ATS1/YAL020CNucleotide change(s) in the coding region of ATS1/YAL020C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 305 is now Glycine rather than Alanine.

             |||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||
MAK16/YAL025CNucleotide change(s) in the coding region of MAK16/YAL025C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 250 is now Glutamic Acid rather than Glutamine.
            ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
DRS2/YAL026CNucleotide change(s) in the coding region of DRS2/YAL026C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 45-46 are now AN rather than GY, residue 450 is now Alanine rather than Arginine, residue 674 is now Proline rather than Glycine, residues 891-892 are now NT rather than KS, residues 953-954 are now GD rather than AS, and residue 987 is now Valine rather than Leucine.
             |||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||
             ||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
SPC72/YAL047CNucleotide change(s) in the coding region of SPC72/YAL047C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 302 is now Asparagine rather than Isoleucine.
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
OAF1/YAL051WNucleotide change(s) in the coding region of OAF1/YAL051W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 70 is now Arginine rather than Tryptophan, residue 447 is now Glutamine rather than Proline, and residue 588 is now Lysine rather than Threonine.
             ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
FLC2/YAL053WNucleotide change(s) in the coding region of FLC2/YAL053W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 111 is now Cysteine rather than Serine, residue 312 is now Asparagine rather than Aspartic Acid, and residues 641-643 are now NDS rather than IDP.
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
             | |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
GPB2/YAL056WNucleotide change(s) in the coding region of GPB2/YAL056W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 661 is now Valine rather than Isoleucine, residue 802 is now Cysteine rather than Phenylalanine, and residues 814-815 are now ED rather than AA.
             |||| ||||||||||||||||||||||||||||||||||| || ||||||||||||||||
YAL059C-ANucleotide change(s) in the coding region of YAL059C-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 36 is now Alanine rather than Serine.

            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
ECM1/YAL059WNucleotide change(s) in the coding region of ECM1/YAL059W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 102 is now Alanine rather than Aspartic Acid.
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
BDH1/YAL060WNucleotide change(s) in the coding region of BDH1/YAL060W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 322 is now Aspartic Acid rather than Alanine.
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
YAL064WA single A nucleotide was inserted within ORF YAL064W, near its 5' end, moving the start codon out of frame with the rest of the protein. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 14 amino acids shorter.
        |||||| |||||||||||||||||||||||| 
BUD14/YAR014CSix separate single nucleotides were inserted within ORF BUD14/YAR014C, and three single nucleotide substitutions were also made, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now two amino acids longer and a small section of the protein sequence is now different.
              ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| 
              ||||||||||||| |||||||||||||||||||| ||||| ||||| ||||||| ||||| 
              |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| 

              ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| 
CDC15/YAR019CNucleotide change(s) in the coding region of CDC15/YAR019C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 316 is now Alanine rather than Arginine, residue 321 is now Alanine rather than Proline, and 900-902 are now KDV rather than NGC.
             |||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
YAR019W-AA single C nucleotide was inserted very near the 3' end of ORF YAR019W-A, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 4 amino acids shorter.
         ||||||||||| ||||||||||||||||||||| 
YAR023CNucleotide change(s) in the coding region of YAR023C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 20 is now Phenylalanine rather than Valine, and residue 46 is now Phenylalanine rather than Isoleucine.
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
            ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
HIR1/YBL008WNucleotide change(s) in the coding region of HIR1/YBL008W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 260 is now Valine rather than Methionine.
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
RRN6/YBL014CNucleotide change(s) in the coding region of RRN6/YBL014C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 39 is now Lysine rather than Asparagine.
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
PTC3/YBL056WNucleotide change(s) in the coding region of PTC3/YBL056W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 369 is now Glycine rather than Aspartic Acid.
             ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||
PTH2/YBL057COne nucleotide was deleted within ORF PTH2/YBL057C, near its 5' end, altering its coding sequence. The stop and reading frame remain the same, but the start has been moved 18 nucleotides downstream and the annotated protein sequence is now six amino acids shorter.
UBP13/YBL067CNucleotide change(s) in the coding region of UBP13/YBL067C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 180 is now Glutamine rather than Histidine.

PRS4/YBL068WOne nucleotide substitution and one trinucleotide deletion were made with the ORF PRS4/YBL068W, altering its coding sequence. The start, stop, and reading frame remain the same, but the annotated protein is now one amino acid shorter.
          |||||||||||||||||||||||| |   |||||||||||||||||||||||||||||||
PET112/YBL080CNucleotide change(s) in the coding region of PET112/YBL080C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 415 is now Proline rather than Alanine.
             |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
CDC27/YBL084CNucleotide change(s) in the coding region of CDC27/YBL084C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 430 is now Serine rather than Glutamine.

             |||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||
TEL1/YBL088CNucleotide change(s) in the coding region of TEL1/YBL088C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1412 is now Cysteine rather than Phenylalanine.
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
MAP2/YBL091CNucleotide change(s) in the coding region of MAP2/YBL091C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 86 is now Aspartic Acid rather than Valine.
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
BRN1/YBL097WNucleotide change(s) in the coding region of BRN1/YBL097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 517 is now Glycine rather than Alanine.

             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
ATP1/YBL099WNucleotide change(s) in the coding region of ATP1/YBL099W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 340 is now Serine rather than Proline.
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
PKC1/YBL105CNucleotide change(s) in the coding region of PKC1/YBL105C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 81 is now Cysteine rather than Phenylalanine, residue 621 is now Arginine rather than Lysine, and residue 789 is now Alanine rather than Proline.
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
SRO77/YBL106CNucleotide change(s) in the coding region of SRO77/YBL106C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 130 is now Isoleucine rather than Phenylalanine, residue 135 is now Serine rather than Proline, residue 260 is now Serine rather than Alanine, residue 834 is now Glycine rather than Valine, residue 858 is now Threonine rather than Serine, and 943 is now Glutamic Acid rather than Lysine.
             ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
             |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
             |||||||||||||| |||||||||||||||||||||||||||||||||||  ||||||||
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
GPI18/YBR004CNucleotide change(s) in the coding region of GPI18/YBR004C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 187 is now Serine rather than Threonine.
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
DSF2/YBR007CNucleotide change(s) in the coding region of DSF2/YBR007C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 205 is now Serine rather than Arginine, and residue 327 is now Proline rather than Threonine.
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||

             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
QDR3/YBR043CNucleotide change(s) in the coding region of QDR3/YBR043C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 37 is now Serine rather than Threonine.
             |||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||
TCM62/YBR044COne nucleotide was deleted within ORF TCM62/YBR044C, very near its 3' end, altering its coding sequence. The start, stop, and majority of reading frame remain the same, but the C-terminus is different and the annotated protein sequence is now one amino acid shorter.
           |||||||||||| ||||||||||||||||||||||||||
GIP1/YBR045CA single nucleotide was inserted within ORF GIP1/YBR045C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 66 amino acids longer.
              ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| 
BAP2/YBR068CNucleotide change(s) in the coding region of BAP2/YBR068C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 139 is now Valine rather than Glutamic Acid, and residue 203 is now Tryptophan rather than Glycine.
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
RDH54/YBR073WNucleotide change(s) in the coding region of RDH54/YBR073W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 752 is now Alanine rather than Arginine.
             |||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||
YBR074WNucleotide change(s) in the coding region of YBR074W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 832 is now Asparagine rather than Phenylalanine.
             |||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||
ECM8/YBR076WA single G nucleotide was deleted near the 3' end, and a single A nucleotide was inserted near the 5' end of ORF ECM8/YBR076W, altering its coding sequence. The ORF was extended 49 amino acids at the N-terminus and shortened 34 amino acids at the C-terminus, resulting in a protein that is 15 amino acids larger. Although this protein is altered at both ends, the central portion of the protein remains the same.
        ||||||||||||| |||||||||||||||||| 
         ||||||||| |||||||||||||||| 
ECM33/YBR078WOne nucleotide was inserted within ORF ECM33/YBR078W, very near its 3' end, altering its coding sequence. The start, stop, and vast majority of reading frame remain the same, but the C-terminus is different and the annotated protein sequence is now 39 amino acids shorter.
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
NHP6B/YBR089C-ANucleotide change(s) in the coding region of NHP6B/YBR089C-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 30 is now Glycine rather than Arginine.
            ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||
YBR090CNucleotide change(s) in the coding region of YBR090C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 101 is now Alanine rather than Glycine.
            | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PBY1/YBR094WNucleotide change(s) in the coding region of PBY1/YBR094W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 450 is now Alanine rather than Arginine.

             |||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||
VPS15/YBR097WNucleotide change(s) in the coding region of VPS15/YBR097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 134 is now Alanine rather than Threonine, and residue 851 is now Arginine rather than Isoleucine.
             ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
AIM3/YBR108WNucleotide change(s) in the coding region of AIM3/YBR108W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 515 is now Valine rather than Alanine.
             ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
GRS1/YBR121CNucleotide change(s) in the coding region of GRS1/YBR121C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 563-564 are now TT rather than HH.
             ||||||  |  |||||||||||||||||||||||||||||||||||||||||||||||||
YBR137WNucleotide change(s) in the coding region of YBR137W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 110 is now Glycine rather than Serine.
            ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
YBR138CNucleotide change(s) in the coding region of YBR138C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 122 is now Leucine rather than Cysteine.
             ||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||
YBR141CNucleotide change(s) in the coding region of YBR141C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 312 is now Proline rather than Serine.
             ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
MCM7/YBR202WNucleotide change(s) in the coding region of MCM7/YBR202W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 552-558 is now GINTTLN rather than VINTNPG, and residue 574 is now Tyrosine rather than Isoleucine.
             |||||||||||||||||||||||||||||||||| ||||||||||| |  |  |||||||
             |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||
COS111/YBR203WNucleotide change(s) in the coding region of COS111/YBR203W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 727-731 are now TFRQH rather than SWRND, residue 917 is now Asparagine rather than Serine, and residue 921 is now Glutamic Acid rather than Glycine.
             |||||||||||||||||||  |  ||  |  |||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||
New    2761  GAAAGCATCATAT  2773
             | |||||||||||
Old    2761  GGAAGCATCATAT  2773
YBR204CNucleotide change(s) in the coding region of YBR204C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 63 is now Valine rather than Glutamic Acid.
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
FTH1/YBR207WNucleotide change(s) in the coding region of FTH1/YBR207W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 18 is now Glutamic Acid rather than Lysine, residue 36 is now Glycine rather than Aspartic Acid, residue 228 is now Glutamic Acid rather than Glutamine, residues249-250 are now VF rather than YS, residue 334 is now Glycine rather than Glutamic Acid, residues 389-390 are now IC rather than KY, and residues 399-401 are now EKY rather than GKC.
TSC10/YBR265WNucleotide change(s) in the coding region of TSC10/YBR265W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 255 is now Aspartic Acid rather than Glutamic Acid.

            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
SLM6/YBR266CNucleotide change(s) in the coding region of SLM6/YBR266C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 31 is now Serine rather than Threonine.
            |||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||
REI1/YBR267WNucleotide change(s) in the coding region of REI1/YBR267W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 152-153 are now KL rather than NV.
             |||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||
BIT2/YBR270CNucleotide change(s) in the coding region of BIT2/YBR270C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 152-153 are now SG rather than RA.

             ||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||
RIF1/YBR275CNucleotide change(s) in the coding region of RIF1/YBR275C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 732 is now Alanine rather than Threonine.
             ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
YBR285WNucleotide change(s) in the coding region of YBR285W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 55 is now Aspartic Acid rather than Histidine.
            |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
APM3/YBR288CNucleotide change(s) in the coding region of APM3/YBR288C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 35-36 are now QS rather than RT.

             |||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||
SNF5/YBR289WNucleotide change(s) in the coding region of SNF5/YBR289W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 564 is now Aspartic Acid rather than Glutamic Acid.
             ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
PCA1/YBR295WNucleotide change(s) in the coding region of PCA1/YBR295W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 382 is now Histidine rather than Threonine.
             |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||
YCL002CA single T nucleotide was inserted within ORF YCL002C, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 12 amino acids longer.
           ||||||||||||||| |||||||||||||||||||||||||||||||||||||||
PAT1/YCR077CNucleotide change(s) in the coding region of PAT1/YCR077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Aspartic Acid rather than Valine.
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
KIN82/YCR091WNucleotide change(s) in the coding region of KIN82/YCR091W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Valine rather than Methionine.
MPS1/YDL028CNucleotide change(s) in the coding region of MPS1/YDL028C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 211-213 are now TKR rather than RRE.

             |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||
DBP10/YDL031WNucleotide change(s) in the coding region of DBP10/YDL031W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 733-741 are now SHSIEDEIL rather than HILSKMKFW, residue 746 is now Glycine rather than Valine, and residue 764 is now Aspartic Acid rather than Histidine.
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
             || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New    2280  TGAAGATGCGGACCAATTATTAGAAGCACAGgaaaacgaaaacaaaaagaaaaagaaaCC  2339
             |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
POL3/YDL102WNucleotide change(s) in the coding region of POL3/YDL102W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 78-79 are now EL rather than DV.
             |||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||
UFD2/YDL190CNucleotide change(s) in the coding region of UFD2/YDL190C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 102 is now Leucine rather than Serine, and residue 677 is now Valine rather than Aspartic Acid.

             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
SEC31/YDL195WNucleotide change(s) in the coding region of SEC31/YDL195W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 367 is now Threonine rather than Serine.
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
AIM6/YDL237WNucleotide change(s) in the coding region of AIM6/YDL237W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 44 is now Asparagine rather than Aspartic Acid.
             ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
ADY3/YDL239CNucleotide change(s) in the coding region of ADY3/YDL239C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 569 is now Glutamic Acid rather than Glycine.
New    1681  caaaaactgaagagcgagttaaaagaaaaattaatactaagtgaaaaaattcagaaaaat  1740
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
LRG1/YDL240WNucleotide change(s) in the coding region of LRG1/YDL240W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 531 is now Glutamine rather than Histidine.
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
YDR215CA single C nucleotide was inserted within ORF YDR215C, altering its coding sequence. The start and first half of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 10 amino acids longer.

           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
ATP22/YDR350CA single nucleotide was inserted within ORF ATP22/YDR350C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 73 amino acids longer.
               ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| 
OPI7/YDR360WA single C nucleotide was inserted within ORF OPI7/YDR360W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer.
           ||| ||||||||||||||||||||||||
ERD1/YDR414CNucleotide change(s) in the coding region of ERD1/YDR414C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 168 is now Alanine rather than Glycine.

             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
UGO1/YDR470CNucleotide change(s) in the coding region of UGO1/YDR470C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 114 is now Glutamic Acid rather than Glycine.
             |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
PSP1/YDR505CNucleotide change(s) in the coding region of PSP1/YDR505C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 532 is now Lysine rather than Glutamic Acid.
             ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
RBA50/YDR527WNucleotide change(s) in the coding region of RBA50/YDR527W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 192-194 are now EEA rather than GEG.

New    541   TTTgaagaagcaggaaaagaaaaagacgtggaagaagaagcaaaaaCTAATGATGACGTC  600
             |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||
YDR541CNucleotide change(s) in the coding region of YDR541C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Glutamine rather than Glutamic Acid.
New    1021  CAGAACAGATTATGA  1035
Old    1021  GAGAACAGATTATGA  1035
YEN1/YER041WNucleotide change(s) in the coding region of YEN1/YER041W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 59 is now Alanine rather than Proline.
             |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
CEM1/YER061CNucleotide change(s) in the coding region of CEM1/YER061C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 367 is now Alanine rather than Arginine.

             ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||
ALD5/YER073WNucleotide change(s) in the coding region of ALD5/YER073W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 411 is now Glutamic Acid rather than Glycine.
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
PTP3/YER075CNucleotide change(s) in the coding region of PTP3/YER075C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 717 is now Alanine rather than Proline, and residue 738 is now Lysine rather than Q, and residue 857 is now Glutamine rather than Glutamic Acid.
New    2101  gataatgataatgacaacaataataataacaataacaatagtaataTTGCTGTTACTGCT  2160
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New    2161  GCTGCTTGtgatgatgatgatgatgatgatgatgaCGCAATTCTCATAAGAAAAATTCTG  2220
             ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
RAD4/YER162CNucleotide change(s) in the coding region of RAD4/YER162C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 223 is now Valine rather than Glutamic Acid.
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
STE2/YFL026WNucleotide change(s) in the coding region of STE2/YFL026W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 269 is now Lysine rather than Glutamic Acid.
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
YFL034WNucleotide change(s) in the coding region of YFL034W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 323 is now Lysine rather than Asparagine.
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
FAB1/YFR019WNucleotide change(s) in the coding region of FAB1/YFR019W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 2275 is now Arginine rather than Tryptophan.
             |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
SAP155/YFR040WNucleotide change(s) in the coding region of SAP155/YFR040W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 663 is now Asparagine rather than Threonine.
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
YGL041CA single nucleotide was deleted near the middle of ORF YGL041C, shifting its reading frame and altering its coding sequence. The start remains the same, but the C-terminus has changed and the annotated protein is truncated by one-third of its length (from 104 amino acids down to 67 amino acids).

         ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| 
YGL041W-AA single G nucleotide was deleted within ORF YGL041W-A, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 72 amino acids longer.
         |||||||||||||||||||||||| ||||||| 
SDS23/YGL056CNucleotide change(s) in the coding region of SDS23/YGL056C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 180 is now Glycine rather than Alanine.
PKP2/YGL059WNucleotide change(s) in the coding region of PKP2/YGL059W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 224-225 are now SI rather than VY.

             ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||
PUS2/YGL063WNucleotide change(s) in the coding region of PUS2/YGL063W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 136 is now Cysteine rather than Serine.
             ||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||
YGL109WNucleotide change(s) in the coding region of YGL109W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 26 is now Glutamine rather than Lysine.
            ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
MON1/YGL124CNucleotide change(s) in the coding region of MON1/YGL124C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 113 is now Serine rather than Cysteine.

             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
RSM23/YGL129CA single T nucleotide was deleted within ORF RSM23/YGL129C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 38 amino acids shorter.
         |||||||||||||| ||||||||||||||||||||| 
MDS3/YGL197WNucleotide change(s) in the coding region of MDS3/YGL197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 262-264 are now QSE rather than HPK, and residue 403 is now Alanine rather than Arginine.
             |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||
YGL214WA single T nucleotide was inserted within ORF YGL214W very near its 5' end, altering its coding sequence. The reading frame and stop remain the same, but the start has been shifted downstream four nucleotides and the annotated protein is now one amino acid shorter.
         ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| 
PEF1/YGR058WNucleotide change(s) in the coding region of PEF1/YGR058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 324 is now Aspartic Acid rather than Tyrosine.
             ||||||||| ||||||||||||||||||||||||||||||||||||||
YGR067CA single nucleotide substitution was made in the stop codon of ORF YGR067C, destroying it and increasing the length of the annotated protein by 10 amino acids.
              |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| 
ROM1/YGR070WNucleotide change(s) in the coding region of ROM1/YGR070W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 960 is now Valine rather than Alanine.
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
ENP2/YGR145WNucleotide change(s) in the coding region of ENP2/YGR145W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 678 is now Aspartic Acid rather than Glutamic Acid.
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
YGR153WNucleotide change(s) in the coding region of YGR153W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 158 is now Alanine rather than Aspartic Acid.

            ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
TOS2/YGR221CNucleotide change(s) in the coding region of TOS2/YGR221C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 69-91 are now EPSMQDFDPNFEGDLYYLPKMDS rather than NLLCRILTQILRAIYTIYRRWIT.
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
DIE2/YGR227WNucleotide change(s) in the coding region of DIE2/YGR227W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 266 is now Isoleucine rather than Lysine.
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
SLH1/YGR271WNucleotide change(s) in the coding region of SLH1/YGR271W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 51 is now Glutamine rather than Proline, residue 193 is now Lysine rather than Glutamic Acid, and residue 438 is now Serine rather than Proline.

             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
YHL037CA single nucleotide was deleted within the ORF YHL037C, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 26 amino acids shorter.
         |||||| |||||||||||||||||||||||||||||||||||| 
ARN2/YHL047CA single nucleotide was inserted within the ORF ARN2/YHL047C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
          ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||  
YHR049C-AA single nucleotide was deleted near the middle of ORF YHR049C-A, altering its coding sequence. The start remains the same, but the C-terminal half of the protein sequence has changed and the annotated protein is now five amino acids shorter.
         ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| 
YHR056W-ANucleotide change(s) in the coding region of YHR056W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 116 is now Cysteine rather than Glycine.
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
ERG7/YHR072WNucleotide change(s) in the coding region of ERG7/YHR072W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 530 is now Asparagine rather than Aspartic Acid.

             ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
HXT4/YHR092COne single nucleotide was inserted, and two single nucleotides deleted, within the ORF HXT4/YHR092C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer.
              ||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| 
              |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| 
YHR095WA single C nucleotide was inserted within ORF YHR095W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 20 amino acids longer.

           ||||||||| ||||||
Old:  421  GCGCATGCG-AAGTAG  435
MTG2/YHR168WA single G nucleotide was inserted very near the 3' end of ORF MTG2/YHR168W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 19 amino acids longer.
            ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| 
RIX1/YHR197WNucleotide change(s) in the coding region of RIX1/YHR197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 762 is now Glutamic Acid rather than Glycine.
New    2281  GAAGAAGAATAA  2292
             |||| |||||||
Old    2281  GAAGGAGAATAA  2292
YIL012WA single G nucleotide was inserted within the ORF YIL012W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
         |||||||||||||| ||||||||||||||||||||||||||| 
CAB2/YIL083CNucleotide change(s) in the coding region of CAB2/YIL083C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 338 is now Serine rather than Isoleucine.
             |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
SIM1/YIL123WThree nucleotides were inserted near the 5' end of ORF SIM1/YIL123W, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
          ||||||||||||| |||||||  ||||||||||||||||||||||||||||||||||||| 
RPC17/YJL011CNucleotide change(s) in the coding region of RPC17/YJL011C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 159 is now Glycine rather than Alanine.
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||
YJL015CA single nucleotide was inserted within the ORF YJL015C very near its 5' end, necessitating a change in annotation to a downstream start codon. The sequence change makes the longer version of the protein no longer possible in the reference sequence. The stop and reading frame remain the same, but the annotated protein is now 30 amino acids shorter.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
PBS2/YJL128CNucleotide change(s) in the coding region of PBS2/YJL128C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 222-223 are now GL rather than AV.

             |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||
URA2/YJL130CNucleotide change(s) in the coding region of URA2/YJL130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 123 is now Alanine rather than Arginine.
             ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
TPK1/YJL164CNucleotide change(s) in the coding region of TPK1/YJL164C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 79-86 are now SGKYSLQD rather than VGSIVYKN.
             |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
SET2/YJL168CNucleotide change(s) in the coding region of SET2/YJL168C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 594 is now Alanine rather than Phenylalanine, residue 605 is now Alanine rather than Serine, and residue 716 is now Alanine rather than Glycine.

             |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||
             |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
YJL169WNucleotide change(s) in the coding region of YJL169W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 62 is now Alanine rather than Proline.
            ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
YJL171CNucleotide change(s) in the coding region of YJL171C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 366 is now Lysine rather than Leucine, residue 371 is now Alanine rather than Arginine, and residue 374 is now Lysine rather than Asparagine.
             |||||||||||||||  |||||||||||||  ||||||||| ||||||||||||||||||
PFD1/YJL179WNucleotide change(s) in the coding region of PFD1/YJL179W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 74 is now Aspartic Acid rather than Alanine.
            |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
MNN11/YJL183WNucleotide change(s) in the coding region of MNN11/YJL183W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 298 is now Aspartic Acid rather than Glycine.
             |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
MNN5/YJL186WNucleotide change(s) in the coding region of MNN5/YJL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 395 is now Valine rather than Phenylalanine.

             |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
BUD19/YJL188CNucleotide change(s) in the coding region of BUD19/YJL188C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 90 is now Cysteine rather than Tyrosine.
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
YJR098CThree nucleotides were inserted near the middle of ORF YJR098C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
          ||||||||||||||||||||||||||| ||||||||||||| ||| |||||||||||||| 
URA8/YJR103WA single C nucleotide was inserted very near the 3' end of ORF URA8/YJR103W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 14 amino acids longer.
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| 
ECM27/YJR106WNucleotide change(s) in the coding region of ECM27/YJR106W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 219 is now Asparagine rather than Aspartic Acid.
             |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
YJR107WNucleotide change(s) in the coding region of YJR107W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 14 is now Proline rather than Leucine, and residue 66 is now Glycine rather than Proline.
            |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||
            |||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||
YJR129CNucleotide change(s) in the coding region of YJR129C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 118 is now Lysine rather than Threonine.
             |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
NMD5/YJR132WNucleotide change(s) in the coding region of NMD5/YJR132W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 258 is now Alanine rather than Serine.
             ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
YJR149WNucleotide change(s) in the coding region of YJR149W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 402 is now Aspartic Acid rather than Valine.

New    1201  ATTGACGGAAAATAA  1215
             |||| ||||||||||
Old    1201  ATTGTCGGAAAATAA  1215
DAN1/YJR150CNucleotide change(s) in the coding region of DAN1/YJR150C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 115 is now Glutamic Acid rather than Glycine.
            ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
YKL023WNucleotide change(s) in the coding region of YKL023W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 25-26 are now QQ rather than HE.
            ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||
YET1/YKL065CNucleotide change(s) in the coding region of YET1/YKL065C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 16 is now Methionine rather than Valine.

            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
HSL1/YKL101WNucleotide change(s) in the coding region of HSL1/YKL101W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1482 is now Threonine rather than Serine.
             ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MYO3/YKL129CThree nucleotides were inserted within the ORF MYO3/YKL129C, and two nucleotides were substituted in the same region, altering the MYO3 coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
          |||||  |||||||| ||||||||| |||||| ||||||||||||||||||||||||||| 
YKL133CNucleotide change(s) in the coding region of YKL133C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 252 is now Tyrosine rather than Isoleucine.

             |||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||
OCT1/YKL134CSix single nucleotides were inserted near the middle of ORF OCT1/YKL134C, and one nucleotide was inserted and another deleted near its 3' end, altering the OCT1 coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now one amino acid longer and two separate small sections of the protein sequence are now different.
          |||||| |||||| || || ||| ||||| |||||||||||||||||||||||||||||| 
          |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| 
          ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| 
APE2/YKL157WA single G nucleotide was deleted within ORF APE2/YKL157W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids longer.
              |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| 
PTK1/YKL198CFive nucleotide changes were made within the ORF PTK1/YKL198C, altering its coding sequence: one single insertion, two single deletions, and two substitutions. The start and majority of the reading frame remain the same, but a small section of the annotated protein sequence is now different, the C-terminus has changed, and the annotated protein is now 13 amino acids longer.
          || |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| 
          |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| 
MCH2/YKL221WNucleotide change(s) in the coding region of MCH2/YKL221W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 342 is now Alanine rather than Arginine.

             |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||
RSC4/YKR008WNucleotide change(s) in the coding region of RSC4/YKR008W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 390 is now Lysine rather than Isoleucine.
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
YKR012CNucleotide change(s) in the coding region of YKR012C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 98 is now Lysine rather than Glutamine, and residue 109 is now Lysine rather than Glutamine.
            ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
            |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
SAP190/YKR028WA single G nucleotide was inserted within the ORF SAP190/YKR028W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 65 amino acids shorter.
          |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| 
CAF4/YKR036CNucleotide change(s) in the coding region of CAF4/YKR036C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 94-95 are now QR rather than HG.
             |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
PXL1/YKR090WNucleotide change(s) in the coding region of PXL1/YKR090W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Serine rather than Threonine.
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
YLL054CA single nucleotide was inserted very near the 3' end of ORF YLL054C, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 74 amino acids longer.
          ||||||||||||||||||||| ||||||||| 
SPH1/YLR313CA GG dinucleotide was inserted within the ORF SPH1/YLR313C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 131 amino acids shorter.
          ||||||||||||||||||  ||||||||||||| 
CDC3/YLR314CNucleotide change(s) in the coding region of CDC3/YLR314C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 431 is now Glutamine rather than Leucine.
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
EST2/YLR318WNucleotide change(s) in the coding region of EST2/YLR318W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 162 is now Alanine rather than Valine.

             ||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||
YLR402WA single G nucleotide was inserted within the ORF YLR402W near its 5' end, necessitating a change in annotation to a downstream start codon. The sequence change makes the longer version of the protein no longer possible in the reference sequence. The stop and reading frame remain the same, but the annotated protein is now 108 amino acids shorter, less than half its original size.
               ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
YLR407WA single G nucleotide was inserted within the ORF YLR407W near its 3' end, altering its coding sequence. The start and vast majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now one amino acid shorter.
         |||||||||||||||| |||||||||| 
YMR262WNucleotide change(s) in the coding region of YMR262W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 167 is now Cysteine rather than Tryptophan.

            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
YMR290W-ANucleotide change(s) in the coding region of YMR290W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 105-107 are now KKK rather than RKR.
New    301  aaaaaaaaaaaaaagaaaaagcaaataaaaaaTTTTCAATTCGGGTAA  348
            ||||||||||||| ||||| ||||||||||||||||||||||||||||
DYN3/YMR299CNucleotide change(s) in the coding region of DYN3/YMR299C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 223 is now Lysine rather than Threonine.
            ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
YMR317WNucleotide change(s) in the coding region of YMR317W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 271-279 are now VISSEASWA rather than SVSSEASSS.

             ||||||||||||||||||||||||||||||  | | ||||| |||||||||| | |||| 
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
YNL008CA single C nucleotide was deleted within ORF YNL008C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 7 amino acids longer.
        |||||||||||| ||||||||||||||||||| 
APC1/YNL172WNucleotide change(s) in the coding region of APC1/YNL172W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1547 is now Methionine rather than Isoleucine.
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
NOP13/YNL175CNucleotide change(s) in the coding region of NOP13/YNL175C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 296 is now Alanine rather than Glutamic Acid.

             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
YNL176CNucleotide change(s) in the coding region of YNL176C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Phenylalanine rather than Cysteine.
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
MRPL22/YNL177CNucleotide change(s) in the coding region of MRPL22/YNL177C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 151 is now Leucine rather than Phenylalanine.
            |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
YNL181WNucleotide change(s) in the coding region of YNL181W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 262 is now Alanine rather than Proline.

             ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
UBP10/YNL186WNucleotide change(s) in the coding region of UBP10/YNL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 310 is now Glutamic Acid rather than Aspartic Acid.
New    901   ggagaggaggaggaagaagaggaagaagagCTGAAACATAAATCTAGGTCAATCACCCCT  960
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
CHS1/YNL192WNucleotide change(s) in the coding region of CHS1/YNL192W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 815 is now Valine rather than Phenylalanine.
             |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
YNL193WNucleotide change(s) in the coding region of YNL193W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 122 is now Leucine rather than Valine.

             ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SLA2/YNL243WNucleotide change(s) in the coding region of SLA2/YNL243W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 344 is now Alanine rather than Arginine.
             |||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||
BNI1/YNL271CNucleotide change(s) in the coding region of BNI1/YNL271C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 938 is now Alanine rather than Threonine.
             ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
EGT2/YNL327WNucleotide change(s) in the coding region of EGT2/YNL327W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 577 is now Threonine rather than Alanine.

             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
ARG1/YOL058WNucleotide change(s) in the coding region of ARG1/YOL058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 329-332 are now SYFT rather than FLLH.
             ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||
YOL075CNucleotide change(s) in the coding region of YOL075C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1164 is now Alanine rather than Arginine.
             |||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||
BRX1/YOL077CNucleotide change(s) in the coding region of BRX1/YOL077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 161 is now Glycine rather than Cysteine.

RTC1/YOL138CNucleotide change(s) in the coding region of RTC1/YOL138C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 393 is now Cysteine rather than Serine, and residue 548 is now Aspartic Acid rather than Glycine.
             ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
PPM2/YOL141WNucleotide change(s) in the coding region of PPM2/YOL141W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 417 is now Leucine rather than Methionine.
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
RRP40/YOL142WNucleotide change(s) in the coding region of RRP40/YOL142W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 160 is now Leucine rather than Phenylalanine.
CTR9/YOL145CNucleotide change(s) in the coding region of CTR9/YOL145C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 197 is now Lysine rather than Glutamic Acid, residue 674 is now Glutamic Acid rather than Glycine, residue 786 is now Arginine rather than Threonine, residue 903 is now Glutamic Acid rather than Lysine, residue 907 is now Serine rather than Arginine, residues 956-959 are now LIQE rather than IFQV, and residue 987 is now Lysine rather than Glutamine.
ORT1/YOR130CNucleotide change(s) in the coding region of ORT1/YOR130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 105 is now Serine rather than Phenylalanine.
            ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
SFL1/YOR140WNucleotide change(s) in the coding region of SFL1/YOR140W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 446-462 are now FVQYQPQSQQHVTYAKQ rather than LYNTNRSRNQHVTYASE.

             ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||
             ||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMP3/YOR149CNucleotide change(s) in the coding region of SMP3/YOR149C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 122-123 are now IK rather than MQ.
             |||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||
TIM18/YOR297CNucleotide change(s) in the coding region of TIM18/YOR297C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 137 is now Glutamic Acid rather than Glycine.
            ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
MCH5/YOR306CNucleotide change(s) in the coding region of MCH5/YOR306C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 495 is now Cysteine rather than Serine.

             ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
MMT2/YPL224CTwo nucleotide changes were made within the ORF MMT2/YPL224C, altering its coding sequence: one single nucleotide substitution near the 5' end, and one single nucleotide insertion near the 3' end. The start and majority of the reading frame remain the same, but the C-terminus has changed, and the annotated protein is now 35 amino acids longer.
          |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| 
          || |||||||||||||||||||||||||||| 
GLN1/YPR035WNucleotide change(s) in the coding region of GLN1/YPR035W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Threonine rather than Alanine, and residue 264 is now Methionine rather than Threonine.
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
             |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
YPR097WNucleotide change(s) in the coding region of YPR097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 848 is now Serine rather than Glycine.
             ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
THI22/YPR121WNucleotide change(s) in the coding region of THI22/YPR121W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 95 is now Glutamine rather than Histidine.
             |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||