Take our Survey

Reference: Sor F and Fukuhara H (1982) Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast. Nucleic Acids Res 10(5):1625-33

Reference Help


The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.

Reference Type
Journal Article | Research Support, Non-U.S. Gov't
Sor F, Fukuhara H
Primary Lit For
Additional Lit For
Review For

Interaction Annotations

Increase the total number of rows showing on this page by using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table; click on the small "i" buttons located within a cell for an annotation to view further details about experiment type and any other genes involved in the interaction.

Interactor Interactor Type Assay Annotation Action Modification Phenotype Source Reference

Gene Ontology Annotations

Increase the total number of rows showing on this page using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table.

Gene Gene Ontology Term Qualifier Aspect Method Evidence Source Assigned On Annotation Extension Reference

Phenotype Annotations

Increase the total number of rows showing on this page using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table; click on the small "i" buttons located within a cell for an annotation to view further details.

Gene Phenotype Experiment Type Mutant Information Strain Background Chemical Details Reference

Regulation Annotations

Increase the total number of rows displayed on this page using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; to filter the table by a specific experiment type, type a keyword into the Filter box (for example, “microarray”); download this table as a .txt file using the Download button or click Analyze to further view and analyze the list of target genes using GO Term Finder, GO Slim Mapper, SPELL, or YeastMine.

Regulator Target Experiment Assay Construct Conditions Strain Background Reference