The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.
Increase the total number of rows showing on this page using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table.
| Evidence ID | Analyze ID | Gene/Complex | Systematic Name/Complex Accession | Qualifier | Gene Ontology Term ID | Gene Ontology Term | Aspect | Annotation Extension | Evidence | Method | Source | Assigned On | Reference |
|---|
Increase the total number of rows showing on this page using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table; click on the small "i" buttons located within a cell for an annotation to view further details.
| Evidence ID | Analyze ID | Gene | Gene Systematic Name | Phenotype | Experiment Type | Experiment Type Category | Mutant Information | Strain Background | Chemical | Details | Reference |
|---|
Increase the total number of rows showing on this page using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table.
| Evidence ID | Analyze ID | Gene | Gene Systematic Name | Disease Ontology Term | Disease Ontology Term ID | Qualifier | Evidence | Method | Source | Assigned On | Reference |
|---|
Increase the total number of rows displayed on this page using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; to filter the table by a specific experiment type, type a keyword into the Filter box (for example, “microarray”); download this table as a .txt file using the Download button or click Analyze to further view and analyze the list of target genes using GO Term Finder, GO Slim Mapper, SPELL, or YeastMine.
| Evidence ID | Analyze ID | Regulator | Regulator Systematic Name | Target | Target Systematic Name | Direction | Regulation of | Happens During | Regulator Type | Direction | Regulation Of | Happens During | Method | Evidence | Strain Background | Reference |
|---|
Increase the total number of rows showing on this page by using the pull-down located below the table, or use the page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table.
| Site | Modification | Modifier | Source | Reference |
|---|
Increase the total number of rows showing on this page by using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table; click on the small "i" buttons located within a cell for an annotation to view further details about experiment type and any other genes involved in the interaction.
| Evidence ID | Analyze ID | Interactor | Interactor Systematic Name | Interactor | Interactor Systematic Name | Allele | Assay | Annotation | Action | Phenotype | SGA score | P-value | Source | Reference | Note |
|---|
Increase the total number of rows showing on this page by using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table; click on the small "i" buttons located within a cell for an annotation to view further details about experiment type and any other genes involved in the interaction.
| Evidence ID | Analyze ID | Interactor | Interactor Systematic Name | Interactor | Interactor Systematic Name | Assay | Annotation | Action | Modification | Source | Reference | Note |
|---|
Increase the total number of rows showing on this page by using the pull-down located below the table, or use the page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table.
| Complement ID | Locus ID | Gene | Species | Gene ID | Strain background | Direction | Details | Source | Reference |
|---|
Increase the total number of rows displayed on this page using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table; download this table as a .txt file using the Download button;
| Evidence ID | Analyze ID | Dataset | Description | Keywords | Number of Conditions | Reference |
|---|