This page displays data from Segal et al and was kindly provided to SGD by Eran Segal.

Module 7 (39 Genes) - Stress Analysis
Jump to: Significant GO annotations | Significant Motif Binding Sites.
Predicted Regulatory Module
The control program is a set of gene products predicted to regulate the cluster of genes below. The prediction is based on the relationship between the expression of the regulator and the expression of genes in the cluster as described in Segal et al. In several instances, there is direct experimental evidence to corroborate the predicted function of the regulators. In this view, the regulators (circled gene products) are in a hierarchy according to their effects on gene expression in the experiments directly below them.


Jump to: Predicted Control Program | Significant Motif Binding Sites.
 
Significant GO Annotations
This table lists, in order of significance, all GO annotations enriched in this cluster at a pvalue below 0.01. For each significant GO annotation, this table displays the following statistics: the number of genes in the cluster with the annotation (Hits), the percentage of genes in the cluster with the annotation (Hits (%)), the total number of genes in the entire dataset with the annotation (Total) and the pvalue of the annotation enrichment.
GO Term Ontology Hits Hits (%) Total Pvalue
molecular_function unknown Molecular Function 24 61.53 923 0.00235065


Jump to: Predicted Control Program | Significant GO Annotations.
 
Significant Motif Binding Sites
This table lists, in order of significance, all motif binding sites enriched in this cluster at a pvalue below 0.01. For each significant motif binding site, the following statistics are displayed: the number of genes in the cluster with the binding site in their promoter (Hits), the percentage of genes with the binding site in their promoter (Hits (%)), the total number of genes in the dataset with the binding site in their promoter (Total) and the pvalue of the binding site enrichment. To view the sequence logo for each motif, click on the motif name.
Motif Source Consensus Hits Hits (%) Total Pvalue
HAP1_B TRANSFAC CCGGAGATATCGGC 12 30.76 355 0.00793056
FACBCA_Q2 TRANSFAC CTCGCTCCCCTCCCGCGGGGAGCTAT 8 20.51 161 0.00402893