This page displays data from Segal et al and was kindly provided to SGD by Eran Segal.

Module 17 (71 Genes) - Stress Analysis
Jump to: Significant GO annotations | Significant Motif Binding Sites.
Predicted Regulatory Module
The control program is a set of gene products predicted to regulate the cluster of genes below. The prediction is based on the relationship between the expression of the regulator and the expression of genes in the cluster as described in Segal et al. In several instances, there is direct experimental evidence to corroborate the predicted function of the regulators. In this view, the regulators (circled gene products) are in a hierarchy according to their effects on gene expression in the experiments directly below them.


Jump to: Predicted Control Program | Significant Motif Binding Sites.
 
Significant GO Annotations
This table lists, in order of significance, all GO annotations enriched in this cluster at a pvalue below 0.01. For each significant GO annotation, this table displays the following statistics: the number of genes in the cluster with the annotation (Hits), the percentage of genes in the cluster with the annotation (Hits (%)), the total number of genes in the entire dataset with the annotation (Total) and the pvalue of the annotation enrichment.
GO Term Ontology Hits Hits (%) Total Pvalue
nucleus Cellular Component 38 53.52 400 8.01453e-13
regulation of transcription\, DNA-dependent Biological Process 24 33.80 189 2.02443e-10
transcription\, DNA-dependent Biological Process 21 29.57 161 2.28284e-09
transcription Biological Process 21 29.57 178 1.45223e-08
nucleobase\, nucleoside\, nucleotide and nucleic acid metabolism Biological Process 30 42.25 366 2.95591e-08
cell Cellular Component 56 78.87 1181 3.0865e-07
transcription from Pol II promoter Biological Process 12 16.90 69 4.38586e-07
transcription regulator activity Molecular Function 21 29.57 227 9.9659e-07
chromatin modeling Biological Process 9 12.67 45 4.13107e-06
cell proliferation Biological Process 16 22.53 156 6.72735e-06
nucleoplasm Cellular Component 11 15.49 75 7.70998e-06
regulation of transcription from Pol II promoter Biological Process 15 21.12 140 8.00964e-06
regulation of transcription Biological Process 7 9.85 39 0.000106295
intracellular Cellular Component 28 39.43 490 0.000134042
cytokinesis Biological Process 9 12.67 73 0.000210316
nuclear division Biological Process 7 9.85 50 0.000506827
physiological processes Biological Process 60 84.50 1589 0.00054025
bud neck Cellular Component 5 7.04 25 0.000649478
meiosis Biological Process 6 8.45 39 0.000781178
ATPase activity Molecular Function 6 8.45 39 0.000781178
transcriptional gene silencing Biological Process 5 7.04 26 0.000781338
gene silencing Biological Process 5 7.04 26 0.000781338
chromatin silencing Biological Process 5 7.04 26 0.000781338
M phase Biological Process 7 9.85 54 0.000802849
incipient bud site Cellular Component 3 4.22 7 0.000818194
endomembrane system Cellular Component 21 29.57 361 0.00090596
site of polarized growth (sensu Saccharomyces) Cellular Component 6 8.45 43 0.00130249
site of polarized growth (sensu Fungi) Cellular Component 6 8.45 43 0.00130249
site of polarized growth Cellular Component 6 8.45 43 0.00130249
DNA binding activity Molecular Function 8 11.26 85 0.00262334
ATP binding activity Molecular Function 5 7.04 35 0.00297561
transcription factor binding activity Molecular Function 4 5.63 22 0.00329778
M phase of mitotic cell cycle Biological Process 5 7.04 36 0.00335724
mitotic cell cycle Biological Process 5 7.04 37 0.00377133
transcription cofactor activity Molecular Function 4 5.63 24 0.0045192
DNA replication and chromosome cycle Biological Process 5 7.04 39 0.00470169
cell cycle Biological Process 8 11.26 98 0.00594384
DNA dependent DNA replication Biological Process 4 5.63 26 0.00599785
shmoo tip Cellular Component 4 5.63 27 0.0068384
transcription co-repressor activity Molecular Function 3 4.22 14 0.00692518
chromatin silencing at telomere Biological Process 3 4.22 14 0.00692518
mitosis Biological Process 5 7.04 43 0.00700169
bud Cellular Component 3 4.22 15 0.00840502
metabolism Biological Process 43 60.56 1130 0.00954124
cell growth and/or maintenance Biological Process 21 29.57 447 0.00969793
S phase of mitotic cell cycle Biological Process 4 5.63 30 0.00978236


Jump to: Predicted Control Program | Significant GO Annotations.
 
Significant Motif Binding Sites
This table lists, in order of significance, all motif binding sites enriched in this cluster at a pvalue below 0.01. For each significant motif binding site, the following statistics are displayed: the number of genes in the cluster with the binding site in their promoter (Hits), the percentage of genes with the binding site in their promoter (Hits (%)), the total number of genes in the dataset with the binding site in their promoter (Total) and the pvalue of the binding site enrichment. To view the sequence logo for each motif, click on the motif name.
Motif Source Consensus Hits Hits (%) Total Pvalue
ABF1_01 TRANSFAC CCATATCATTATATACGAAACT 23 32.39 426 0.00259591
ABF_C TRANSFAC TATCACTATAAACGA 30 42.25 545 0.000358478
TAF_Q6 TRANSFAC CGTCCGAAACGACCA 25 35.21 367 6.11222e-05