This page displays data from Segal et al and was kindly provided to SGD by Eran Segal.

Module 23 (53 Genes) - Stress Analysis
Jump to: Significant GO annotations | Significant Motif Binding Sites.
Predicted Regulatory Module
The control program is a set of gene products predicted to regulate the cluster of genes below. The prediction is based on the relationship between the expression of the regulator and the expression of genes in the cluster as described in Segal et al. In several instances, there is direct experimental evidence to corroborate the predicted function of the regulators. In this view, the regulators (circled gene products) are in a hierarchy according to their effects on gene expression in the experiments directly below them.


Jump to: Predicted Control Program | Significant Motif Binding Sites.
 
Significant GO Annotations
This table lists, in order of significance, all GO annotations enriched in this cluster at a pvalue below 0.01. For each significant GO annotation, this table displays the following statistics: the number of genes in the cluster with the annotation (Hits), the percentage of genes in the cluster with the annotation (Hits (%)), the total number of genes in the entire dataset with the annotation (Total) and the pvalue of the annotation enrichment.
GO Term Ontology Hits Hits (%) Total Pvalue
purine base metabolism Biological Process 6 11.32 12 7.98047e-08
polyamine transporter activity Molecular Function 6 11.32 16 6.37759e-07
amino acid metabolism Biological Process 11 20.75 89 2.19366e-06
amino acid transport Biological Process 6 11.32 21 3.90416e-06
porter activity Molecular Function 6 11.32 24 9.1103e-06
sulfur metabolism Biological Process 8 15.09 54 1.6182e-05
transport Biological Process 13 24.52 163 3.08141e-05
amino acid transporter activity Molecular Function 5 9.43 19 4.15512e-05
physiological processes Biological Process 48 90.56 1589 5.70614e-05
amine metabolism Biological Process 8 15.09 68 8.71237e-05
amino acid biosynthesis Biological Process 5 9.43 23 0.000110652
transporter activity Molecular Function 16 30.18 274 0.00014403
amino acid-polyamine transporter activity Molecular Function 4 7.54 14 0.000185672
enzyme activity Molecular Function 26 49.05 644 0.000351513
amino acid and derivative metabolism Biological Process 7 13.20 63 0.000351765
sulfur amino acid metabolism Biological Process 5 9.43 32 0.000548987
electrochemical potential-driven transporter activity Molecular Function 4 7.54 19 0.000646729
plasma membrane Cellular Component 11 20.75 175 0.000998304
nucleobase metabolism Biological Process 3 5.66 10 0.00111225
regulation of nucleobase\, nucleoside\, nucleotide and nucleic acid metabolism Biological Process 3 5.66 10 0.00111225
ligase activity\, forming carbon-nitrogen bonds Molecular Function 4 7.54 23 0.0013573
extracellular Cellular Component 13 24.52 243 0.0014551
organic acid metabolism Biological Process 8 15.09 110 0.00207989
carboxylic acid metabolism Biological Process 8 15.09 110 0.00207989
immunoglobulin complex Cellular Component 7 13.20 92 0.0030826
sulfur amino acid biosynthesis Biological Process 3 5.66 16 0.00456025
aromatic compound metabolism Biological Process 3 5.66 19 0.00739535
ATP-binding cassette (ABC) transporter activity Molecular Function 4 7.54 37 0.00751356
carrier activity Molecular Function 5 9.43 60 0.00826924
heterocycle metabolism Biological Process 3 5.66 20 0.00851418
response to chemical substance Biological Process 5 9.43 62 0.00939207


Jump to: Predicted Control Program | Significant GO Annotations.
 
Significant Motif Binding Sites
This table lists, in order of significance, all motif binding sites enriched in this cluster at a pvalue below 0.01. For each significant motif binding site, the following statistics are displayed: the number of genes in the cluster with the binding site in their promoter (Hits), the percentage of genes with the binding site in their promoter (Hits (%)), the total number of genes in the dataset with the binding site in their promoter (Total) and the pvalue of the binding site enrichment. To view the sequence logo for each motif, click on the motif name.
Motif Source Consensus Hits Hits (%) Total Pvalue
GCN4_01 TRANSFAC CCCGTGCCGATGACTCATCCCGCGCCC 23 43.39 462 8.52892e-05
GCN4_C TRANSFAC CAATGACTCA 16 30.18 287 0.000445573