This page displays data from Segal et al and was kindly provided to SGD by Eran Segal.

Module 29 (37 Genes) - Stress Analysis
Jump to: Significant GO annotations | Significant Motif Binding Sites.
Predicted Regulatory Module
The control program is a set of gene products predicted to regulate the cluster of genes below. The prediction is based on the relationship between the expression of the regulator and the expression of genes in the cluster as described in Segal et al. In several instances, there is direct experimental evidence to corroborate the predicted function of the regulators. In this view, the regulators (circled gene products) are in a hierarchy according to their effects on gene expression in the experiments directly below them.


Jump to: Predicted Control Program | Significant Motif Binding Sites.
 
Significant GO Annotations
This table lists, in order of significance, all GO annotations enriched in this cluster at a pvalue below 0.01. For each significant GO annotation, this table displays the following statistics: the number of genes in the cluster with the annotation (Hits), the percentage of genes in the cluster with the annotation (Hits (%)), the total number of genes in the entire dataset with the annotation (Total) and the pvalue of the annotation enrichment.
GO Term Ontology Hits Hits (%) Total Pvalue
nucleosome Cellular Component 4 10.81 10 9.96642e-06
chromatin assembly/disassembly Biological Process 4 10.81 13 3.25202e-05
amino acid and derivative metabolism Biological Process 7 18.91 63 3.4791e-05
amino acid metabolism Biological Process 8 21.62 89 4.22036e-05
amine metabolism Biological Process 7 18.91 68 5.70712e-05
DNA packaging Biological Process 4 10.81 20 0.000199501
establishment and/or maintenance of chromatin architecture Biological Process 4 10.81 20 0.000199501
defense response Biological Process 4 10.81 20 0.000199501
chromatin Cellular Component 4 10.81 21 0.000242959
enzyme activity Molecular Function 20 54.05 644 0.000346922
chromosome organization and biogenesis (sensu Eukarya) Biological Process 4 10.81 27 0.000654034
branched chain family amino acid metabolism Biological Process 3 8.10 12 0.000689546
ethylene metabolism Biological Process 3 8.10 13 0.000883401
hormone biosynthesis Biological Process 3 8.10 13 0.000883401
ethylene biosynthesis Biological Process 3 8.10 13 0.000883401
amino acid derivative biosynthesis Biological Process 3 8.10 13 0.000883401
organic acid metabolism Biological Process 7 18.91 110 0.00107045
carboxylic acid metabolism Biological Process 7 18.91 110 0.00107045
lyase activity Molecular Function 5 13.51 54 0.00116326
physiological processes Biological Process 33 89.18 1589 0.00160298
methionine metabolism Biological Process 3 8.10 16 0.00165546
chromosome Cellular Component 4 10.81 36 0.00193008
jasmonic acid/ethylene dependent systemic resistance Biological Process 3 8.10 17 0.00198098
response to wounding Biological Process 3 8.10 17 0.00198098
response to pathogenic fungi (incompatible interaction) Biological Process 3 8.10 17 0.00198098
response to pathogenic bacteria (incompatible interaction) Biological Process 3 8.10 17 0.00198098
hydro-lyase activity Molecular Function 3 8.10 18 0.00234261
carbon-oxygen lyase activity Molecular Function 3 8.10 22 0.00416921


Jump to: Predicted Control Program | Significant GO Annotations.
 
Significant Motif Binding Sites
This table lists, in order of significance, all motif binding sites enriched in this cluster at a pvalue below 0.01. For each significant motif binding site, the following statistics are displayed: the number of genes in the cluster with the binding site in their promoter (Hits), the percentage of genes with the binding site in their promoter (Hits (%)), the total number of genes in the dataset with the binding site in their promoter (Total) and the pvalue of the binding site enrichment. To view the sequence logo for each motif, click on the motif name.
Motif Source Consensus Hits Hits (%) Total Pvalue
GCN4_01 TRANSFAC CCCGTGCCGATGACTCATCCCGCGCCC 16 43.24 469 0.000982975