This page displays data from Segal et al and was kindly provided to SGD by Eran Segal.

Module 41 (39 Genes) - Stress Analysis
Jump to: Significant GO annotations | Significant Motif Binding Sites.
Predicted Regulatory Module
The control program is a set of gene products predicted to regulate the cluster of genes below. The prediction is based on the relationship between the expression of the regulator and the expression of genes in the cluster as described in Segal et al. In several instances, there is direct experimental evidence to corroborate the predicted function of the regulators. In this view, the regulators (circled gene products) are in a hierarchy according to their effects on gene expression in the experiments directly below them.


Jump to: Predicted Control Program | Significant Motif Binding Sites.
 
Significant GO Annotations
This table lists, in order of significance, all GO annotations enriched in this cluster at a pvalue below 0.01. For each significant GO annotation, this table displays the following statistics: the number of genes in the cluster with the annotation (Hits), the percentage of genes in the cluster with the annotation (Hits (%)), the total number of genes in the entire dataset with the annotation (Total) and the pvalue of the annotation enrichment.
GO Term Ontology Hits Hits (%) Total Pvalue
amino acid and derivative metabolism Biological Process 11 28.20 63 1.81439e-09
amine metabolism Biological Process 11 28.20 68 4.24757e-09
amino acid metabolism Biological Process 12 30.76 89 6.34279e-09
organic acid metabolism Biological Process 12 30.76 110 7.29864e-08
carboxylic acid metabolism Biological Process 12 30.76 110 7.29864e-08
hydrolase activity\, acting on carbon-nitrogen (but not peptide) bonds\, in linear amides Molecular Function 5 12.82 10 2.24408e-07
cellular response to starvation Biological Process 4 10.25 8 4.24151e-06
response to starvation Biological Process 4 10.25 8 4.24151e-06
hydrolase activity\, acting on carbon-nitrogen (but not peptide) bonds Molecular Function 5 12.82 19 9.07733e-06
ornithine metabolism Biological Process 4 10.25 10 1.23478e-05
non-protein amino acid metabolism Biological Process 4 10.25 10 1.23478e-05
urea cycle intermediate metabolism Biological Process 4 10.25 10 1.23478e-05
response to stress Biological Process 11 28.20 167 4.01586e-05
response to biotic stimulus Biological Process 8 20.51 86 4.90405e-05
glutamine family amino acid metabolism Biological Process 4 10.25 17 0.000125942
amino acid catabolism Biological Process 4 10.25 18 0.000159502
ribosome Cellular Component 8 20.51 105 0.000198215
amino acid transporter activity Molecular Function 4 10.25 19 0.00019901
extracellular transport Biological Process 3 7.69 11 0.000612977
response to extracellular stimulus Biological Process 4 10.25 26 0.000690524
cytosol Cellular Component 7 17.94 98 0.000753793
ethylene metabolism Biological Process 3 7.69 13 0.0010301
amino acid derivative biosynthesis Biological Process 3 7.69 13 0.0010301
ethylene biosynthesis Biological Process 3 7.69 13 0.0010301
hormone biosynthesis Biological Process 3 7.69 13 0.0010301
methionine metabolism Biological Process 3 7.69 16 0.00192535
jasmonic acid/ethylene dependent systemic resistance Biological Process 3 7.69 17 0.00230194
response to wounding Biological Process 3 7.69 17 0.00230194
response to pathogenic bacteria (incompatible interaction) Biological Process 3 7.69 17 0.00230194
response to pathogenic fungi (incompatible interaction) Biological Process 3 7.69 17 0.00230194
ATP-binding cassette (ABC) transporter activity Molecular Function 4 10.25 37 0.00258157
ribonucleoprotein complex Cellular Component 8 20.51 160 0.00292805
physiological processes Biological Process 34 87.17 1589 0.00308498
defense response Biological Process 3 7.69 20 0.00368353
uptake permease activity Molecular Function 4 10.25 42 0.00405437
amino acid transport Biological Process 3 7.69 21 0.0042312
permease activity Molecular Function 4 10.25 43 0.00440256
metabolism Biological Process 26 66.66 1130 0.00815915


Jump to: Predicted Control Program | Significant GO Annotations.
 
Significant Motif Binding Sites
This table lists, in order of significance, all motif binding sites enriched in this cluster at a pvalue below 0.01. For each significant motif binding site, the following statistics are displayed: the number of genes in the cluster with the binding site in their promoter (Hits), the percentage of genes with the binding site in their promoter (Hits (%)), the total number of genes in the dataset with the binding site in their promoter (Total) and the pvalue of the binding site enrichment. To view the sequence logo for each motif, click on the motif name.
Motif Source Consensus Hits Hits (%) Total Pvalue
GCN4_01 TRANSFAC CCCGTGCCGATGACTCATCCCGCGCCC 22 56.41 463 6.3603e-07
GAL4_C TRANSFAC TCGGAGCACTGTCCTCCGAACG 13 33.33 368 0.00406238
GCN4_C TRANSFAC CAATGACTCA 11 28.20 292 0.00537971
LAC9_C TRANSFAC GTCTCGGAATACTGCACTCCGG 13 33.33 365 0.00380789
CBF1_B TRANSFAC AGTCACGTGA 18 46.15 363 7.246e-06