This page displays data from Segal et al and was kindly provided to SGD by Eran Segal.

Module 43 (79 Genes) - Stress Analysis
Jump to: Significant GO annotations | Significant Motif Binding Sites.
Predicted Regulatory Module
The control program is a set of gene products predicted to regulate the cluster of genes below. The prediction is based on the relationship between the expression of the regulator and the expression of genes in the cluster as described in Segal et al. In several instances, there is direct experimental evidence to corroborate the predicted function of the regulators. In this view, the regulators (circled gene products) are in a hierarchy according to their effects on gene expression in the experiments directly below them.


Jump to: Predicted Control Program | Significant Motif Binding Sites.
 
Significant GO Annotations
This table lists, in order of significance, all GO annotations enriched in this cluster at a pvalue below 0.01. For each significant GO annotation, this table displays the following statistics: the number of genes in the cluster with the annotation (Hits), the percentage of genes in the cluster with the annotation (Hits (%)), the total number of genes in the entire dataset with the annotation (Total) and the pvalue of the annotation enrichment.
GO Term Ontology Hits Hits (%) Total Pvalue
protein metabolism Biological Process 35 44.30 409 9.32524e-09
cytoplasm Cellular Component 35 44.30 437 5.48212e-08
cell Cellular Component 60 75.94 1181 1.16594e-06
intracellular protein transport Biological Process 16 20.25 128 2.15625e-06
membrane coat Cellular Component 6 7.59 14 2.75324e-06
metabolism Biological Process 57 72.15 1130 5.47837e-06
intracellular Cellular Component 33 41.77 490 9.24099e-06
RNA localization Biological Process 7 8.86 28 2.25252e-05
vesicle coat Cellular Component 5 6.32 12 2.37305e-05
nucleocytoplasmic transport Biological Process 7 8.86 29 2.87737e-05
protein-nucleus import Biological Process 6 7.59 21 3.98444e-05
protein targeting Biological Process 13 16.45 113 5.12475e-05
nuclear pore Cellular Component 6 7.59 22 5.30725e-05
mRNA-binding (hnRNP) protein-nucleus import Biological Process 5 6.32 14 5.62555e-05
nuclear membrane Cellular Component 7 8.86 33 6.94433e-05
RNA-nucleus export Biological Process 6 7.59 23 6.95572e-05
coated vesicle Cellular Component 5 6.32 16 0.000115101
protein-nucleus export Biological Process 5 6.32 17 0.0001579
protein secretion Biological Process 10 12.65 78 0.000162733
secretory pathway Biological Process 10 12.65 81 0.000221495
endomembrane system Cellular Component 24 30.37 361 0.000276514
mRNA-nucleus export Biological Process 5 6.32 20 0.000359215
snRNP protein-nucleus import Biological Process 4 5.06 12 0.000448705
spindle pole body Cellular Component 4 5.06 12 0.000448705
snRNA-nucleus export Biological Process 4 5.06 12 0.000448705
microtubule organizing center Cellular Component 4 5.06 12 0.000448705
NLS-bearing substrate-nucleus import Biological Process 4 5.06 12 0.000448705
ribosomal protein-nucleus import Biological Process 4 5.06 12 0.000448705
structural molecule activity Molecular Function 8 10.12 58 0.000456643
rRNA-nucleus export Biological Process 4 5.06 13 0.000627383
tRNA-nucleus export Biological Process 4 5.06 13 0.000627383
ER to Golgi transport Biological Process 6 7.59 34 0.000652638
nuclear pore organization and biogenesis Biological Process 4 5.06 14 0.000850208
physiological processes Biological Process 65 82.27 1589 0.00127711
DNA replication and chromosome cycle Biological Process 6 7.59 39 0.00134925
structural constituent of cytoskeleton Molecular Function 4 5.06 17 0.00183326
cell organization and biogenesis Biological Process 11 13.92 132 0.00266668
nuclear organization and biogenesis Biological Process 4 5.06 19 0.00279709
basement membrane Cellular Component 15 18.98 219 0.00311303
extracellular matrix Cellular Component 15 18.98 219 0.00311303
basal lamina Cellular Component 15 18.98 219 0.00311303
extracellular Cellular Component 16 20.25 243 0.00332444
membrane Cellular Component 33 41.77 687 0.00488824
microtubule-based process Biological Process 3 3.79 12 0.00595124
Golgi apparatus Cellular Component 4 5.06 25 0.00750389
cytoskeleton Cellular Component 5 6.32 40 0.00798458
protein transporter activity Molecular Function 4 5.06 26 0.00858277
phosphorus metabolism Biological Process 4 5.06 26 0.00858277
viral life cycle Biological Process 8 10.12 95 0.00897786
endoplasmic reticulum membrane Cellular Component 5 6.32 42 0.00967289
nucleus Cellular Component 21 26.58 400 0.00969055


Jump to: Predicted Control Program | Significant GO Annotations.
 
Significant Motif Binding Sites
This table lists, in order of significance, all motif binding sites enriched in this cluster at a pvalue below 0.01. For each significant motif binding site, the following statistics are displayed: the number of genes in the cluster with the binding site in their promoter (Hits), the percentage of genes with the binding site in their promoter (Hits (%)), the total number of genes in the dataset with the binding site in their promoter (Total) and the pvalue of the binding site enrichment. To view the sequence logo for each motif, click on the motif name.
Motif Source Consensus Hits Hits (%) Total Pvalue
ABF1_01 TRANSFAC CCATATCATTATATACGAAACT 26 32.91 423 0.00117473
ABF_C TRANSFAC TATCACTATAAACGA 32 40.50 543 0.000546374