This page displays data from Segal et al and was kindly provided to SGD by Eran Segal.

Module 47 (37 Genes) - Stress Analysis
Jump to: Significant GO annotations | Significant Motif Binding Sites.
Predicted Regulatory Module
The control program is a set of gene products predicted to regulate the cluster of genes below. The prediction is based on the relationship between the expression of the regulator and the expression of genes in the cluster as described in Segal et al. In several instances, there is direct experimental evidence to corroborate the predicted function of the regulators. In this view, the regulators (circled gene products) are in a hierarchy according to their effects on gene expression in the experiments directly below them.


Jump to: Predicted Control Program | Significant Motif Binding Sites.
 
Significant GO Annotations
This table lists, in order of significance, all GO annotations enriched in this cluster at a pvalue below 0.01. For each significant GO annotation, this table displays the following statistics: the number of genes in the cluster with the annotation (Hits), the percentage of genes in the cluster with the annotation (Hits (%)), the total number of genes in the entire dataset with the annotation (Total) and the pvalue of the annotation enrichment.
GO Term Ontology Hits Hits (%) Total Pvalue
glycolysis Biological Process 10 27.02 12 1.58357e-17
gluconeogenesis Biological Process 10 27.02 17 4.4033e-15
regulation of carbohydrate metabolism Biological Process 10 27.02 21 7.6232e-14
main pathways of carbohydrate metabolism Biological Process 10 27.02 27 1.70024e-12
cytosol Cellular Component 15 40.54 98 2.77098e-12
cytoplasm Cellular Component 25 67.56 437 5.18703e-11
energy pathways Biological Process 10 27.02 46 6.57649e-10
energy derivation by oxidation of organic compounds Biological Process 10 27.02 49 1.27982e-09
ribosome Cellular Component 12 32.43 105 2.21173e-08
intracellular Cellular Component 23 62.16 490 3.63622e-08
regulation of metabolism Biological Process 11 29.72 90 4.8004e-08
carbohydrate metabolism Biological Process 10 27.02 72 6.36085e-08
ribonucleoprotein complex Cellular Component 12 32.43 160 2.34247e-06
cell Cellular Component 30 81.08 1181 7.2197e-05
enzyme activity Molecular Function 21 56.75 644 0.000103389
metabolism Biological Process 29 78.37 1130 0.000105566
basement membrane Cellular Component 11 29.72 219 0.000268581
extracellular matrix Cellular Component 11 29.72 219 0.000268581
basal lamina Cellular Component 11 29.72 219 0.000268581
oxidoreductase activity Molecular Function 8 21.62 117 0.000283499
oxidoreductase activity\, acting on the aldehyde or oxo group of donors\, NAD or NADP as acceptor Molecular Function 3 8.10 11 0.000524771
protein folding Biological Process 4 10.81 26 0.000565148
extracellular Cellular Component 11 29.72 243 0.00064361
oxidoreductase activity\, acting on the aldehyde or oxo group of donors Molecular Function 3 8.10 13 0.000883401
lipid particle Cellular Component 3 8.10 14 0.00110801
protein metabolism Biological Process 14 37.83 409 0.00160565
isomerase activity Molecular Function 3 8.10 19 0.00274137
organelle organization and biogenesis Biological Process 4 10.81 45 0.0042902
physiological processes Biological Process 32 86.48 1589 0.00517772
protein modification Biological Process 6 16.21 115 0.00630833
external encapsulating structure Cellular Component 4 10.81 51 0.0065999
cell wall Cellular Component 4 10.81 51 0.0065999
cytoplasm organization and biogenesis Biological Process 4 10.81 53 0.00751356
establishment of cell polarity (sensu Saccharomyces) Biological Process 3 8.10 28 0.00812048


Jump to: Predicted Control Program | Significant GO Annotations.
 
Significant Motif Binding Sites
This table lists, in order of significance, all motif binding sites enriched in this cluster at a pvalue below 0.01. For each significant motif binding site, the following statistics are displayed: the number of genes in the cluster with the binding site in their promoter (Hits), the percentage of genes with the binding site in their promoter (Hits (%)), the total number of genes in the dataset with the binding site in their promoter (Total) and the pvalue of the binding site enrichment. To view the sequence logo for each motif, click on the motif name.
Motif Source Consensus Hits Hits (%) Total Pvalue
GCR1_01 TRANSFAC GGCTTCCTC 18 48.64 573 0.00105521
GCR1_B TRANSFAC TGGCTTCCACTATT 12 32.43 380 0.00850145
FACBALL_Q2 TRANSFAC CTCTCTCCGCTCTCCCGCGGAGCTTT 6 16.21 75 0.00116433