This page displays data from Segal et al and was kindly provided to SGD by Eran Segal. This page displays data from Segal et al and was kindly provided to SGD by Eran Segal.

Module 48 (62 Genes) - Stress Analysis
Jump to: Significant GO annotations | Significant Motif Binding Sites.
Predicted Regulatory Module
The control program is a set of gene products predicted to regulate the cluster of genes below. The prediction is based on the relationship between the expression of the regulator and the expression of genes in the cluster as described in Segal et al. In several instances, there is direct experimental evidence to corroborate the predicted function of the regulators. In this view, the regulators (circled gene products) are in a hierarchy according to their effects on gene expression in the experiments directly below them.


Jump to: Predicted Control Program | Significant Motif Binding Sites.
 
Significant GO Annotations
This table lists, in order of significance, all GO annotations enriched in this cluster at a pvalue below 0.01. For each significant GO annotation, this table displays the following statistics: the number of genes in the cluster with the annotation (Hits), the percentage of genes in the cluster with the annotation (Hits (%)), the total number of genes in the entire dataset with the annotation (Total) and the pvalue of the annotation enrichment.
GO Term Ontology Hits Hits (%) Total Pvalue
endoplasmic reticulum Cellular Component 16 25.80 75 1.75466e-11
endoplasmic reticulum membrane Cellular Component 12 19.35 42 2.10854e-10
nuclear envelope-endoplasmic reticulum network Cellular Component 12 19.35 45 5.13576e-10
N-linked glycosylation Biological Process 8 12.90 17 2.87387e-09
protein metabolism Biological Process 30 48.38 409 9.16175e-09
glycoprotein biosynthesis Biological Process 8 12.90 20 1.38832e-08
apicolateral plasma membrane Cellular Component 11 17.74 51 3.29579e-08
intercellular junction Cellular Component 11 17.74 51 3.29579e-08
cell junction Cellular Component 11 17.74 51 3.29579e-08
plasmodesma Cellular Component 11 17.74 51 3.29579e-08
plasmodesmatal desmotubule Cellular Component 11 17.74 51 3.29579e-08
protein amino acid glycosylation Biological Process 8 12.90 23 5.03732e-08
oligosaccharyl transferase activity Molecular Function 5 8.06 7 2.15244e-07
secretory pathway Biological Process 12 19.35 81 5.70965e-07
ER to Golgi transport Biological Process 8 12.90 34 1.44073e-06
protein secretion Biological Process 11 17.74 78 2.93115e-06
protein modification Biological Process 13 20.96 115 4.20316e-06
plasma membrane Cellular Component 16 25.80 175 4.65624e-06
transferase activity\, transferring hexosyl groups Molecular Function 7 11.29 29 5.75436e-06
dolichyl-diphospho-oligosaccharide-protein glycosyltransferase activity Molecular Function 4 6.45 6 6.2267e-06
membrane Cellular Component 34 54.83 687 1.12321e-05
terminal glycosylation Biological Process 5 8.06 14 1.7273e-05
transferase activity\, transferring glycosyl groups Molecular Function 7 11.29 37 3.13353e-05
coated vesicle Cellular Component 5 8.06 16 3.58733e-05
COPII-coated vesicle Cellular Component 3 4.83 5 0.000165342
coated vesicle membrane Cellular Component 3 4.83 5 0.000165342
cytoplasmic vesicle membrane Cellular Component 4 6.45 14 0.000340099
integral to membrane Cellular Component 5 8.06 27 0.000505134
metabolism Biological Process 42 67.74 1130 0.000694575
cytoplasmic vesicle Cellular Component 4 6.45 19 0.00116153
vesicle membrane Cellular Component 4 6.45 19 0.00116153
transferase activity Molecular Function 12 19.35 185 0.00176439
cell Cellular Component 42 67.74 1181 0.00194645
enzyme activity Molecular Function 27 43.54 644 0.00222149
endomembrane system Cellular Component 18 29.03 361 0.00241931
lipid metabolism Biological Process 6 9.67 57 0.00273116
vacuole organization and biogenesis Biological Process 3 4.83 15 0.00583111
protein complex assembly Biological Process 3 4.83 16 0.0069958


Jump to: Predicted Control Program | Significant GO Annotations.
 
Significant Motif Binding Sites
This table lists, in order of significance, all motif binding sites enriched in this cluster at a pvalue below 0.01. For each significant motif binding site, the following statistics are displayed: the number of genes in the cluster with the binding site in their promoter (Hits), the percentage of genes with the binding site in their promoter (Hits (%)), the total number of genes in the dataset with the binding site in their promoter (Total) and the pvalue of the binding site enrichment. To view the sequence logo for each motif, click on the motif name.
Motif Source Consensus Hits Hits (%) Total Pvalue
ABF1_01 TRANSFAC CCATATCATTATATACGAAACT 19 30.64 430 0.00961537
REB1_B TRANSFAC GTTACCCGG 30 48.38 721 0.00244382