This page displays data from Segal et al. and was kindly provided to SGD by Eran Segal.

Module 7 (58 Genes) - Cell Cycle Analysis

Jump to: Significant GO annotations | Significant Motif Binding Sites.

Predicted Regulatory Module

The control program is a set of gene products predicted to regulate the cluster of genes below. The prediction is based on the relationship between the expression of the regulator and the expression of genes in the cluster as described in Segal et al. In several instances, there is direct experimental evidence to corroborate the predicted function of the regulators. In this view, the regulators (circled gene products) are in a hierarchy according to their effects on gene expression in the experiments directly below them.

Jump to: Predicted Control Program | Significant Motif Binding Sites.

Significant GO Annotations
This table lists, in order of significance, all GO annotations enriched in this cluster at a pvalue below 0.01. For each significant GO annotation, this table displays the following statistics: the number of genes in the cluster with the annotation (Hits), the percentage of genes in the cluster with the annotation (Hits (%)), the total number of genes in the entire dataset with the annotation (Total) and the pvalue of the annotation enrichment.
GO Term	Ontology	Hits	Hits (%)	Total	Pvalue
transcription regulator activity	Molecular Function	32	55.17	222	1.97158e-10
nucleus	Cellular Component	36	62.06	323	1.3564e-08
endomembrane system	Cellular Component	29	50	271	2.92328e-06
perception of chemical substance	Biological Process	20	34.48	152	9.52577e-06
perception of external stimulus	Biological Process	20	34.48	152	9.52577e-06
perception of abiotic stimulus	Biological Process	20	34.48	153	1.05504e-05
regulation of transcription by pheromones	Biological Process	14	24.13	83	1.72453e-05
RNA polymerase II transcription factor activity	Molecular Function	12	20.68	64	2.54618e-05
chemosensory perception	Biological Process	19	32.75	150	2.98504e-05
response to pheromone	Biological Process	19	32.75	150	2.98504e-05
sensory perception	Biological Process	19	32.75	151	3.28453e-05
regulation of transcription\, DNA-dependent	Biological Process	22	37.93	194	3.40712e-05
regulation of transcription from Pol II promoter	Biological Process	18	31.03	139	3.80123e-05
response to abiotic stimulus	Biological Process	21	36.20	181	3.89027e-05
membrane	Cellular Component	33	56.89	378	4.17662e-05
response to external stimulus	Biological Process	22	37.93	200	5.52424e-05
physiological processes	Biological Process	54	93.10	858	7.65598e-05
cell	Cellular Component	44	75.86	633	0.000243318
specific RNA polymerase II transcription factor activity	Molecular Function	8	13.79	39	0.000342489
transcription factor complex	Cellular Component	5	8.62	15	0.000470479
metabolism	Biological Process	37	63.79	505	0.000554798
regulation of transcription from Pol II promoter by pheromones	Biological Process	8	13.79	44	0.000787139
nucleoplasm	Cellular Component	9	15.51	59	0.00132233
transcriptional activator activity	Molecular Function	6	10.34	28	0.00155155
positive regulation of transcription from Pol II promoter	Biological Process	5	8.62	22	0.0029696
transcription	Biological Process	14	24.13	143	0.00455587
transcription factor activity	Molecular Function	8	13.79	61	0.00602125
nitrogen utilization	Biological Process	3	5.17	9	0.0072318
nucleobase\, nucleoside\, nucleotide and nucleic acid metabolism	Biological Process	20	34.48	254	0.0079767
amino acid and derivative metabolism	Biological Process	4	6.89	18	0.00849965

Jump to: Predicted Control Program | Significant GO Annotations.

Significant Motif Binding Sites
This table lists, in order of significance, all motif binding sites enriched in this cluster at a pvalue below 0.01. For each significant motif binding site, the following statistics are displayed: the number of genes in the cluster with the binding site in their promoter (Hits), the percentage of genes with the binding site in their promoter (Hits (%)), the total number of genes in the dataset with the binding site in their promoter (Total) and the pvalue of the binding site enrichment. To view the sequence logo for each motif, click on the motif name.
Motif	Source	Consensus	Hits	Hits (%)	Total	Pvalue
ABF1_01	TRANSFAC	CCATATCATTATATACGAAACT	19	32.75	198	0.00328423
TAF_Q6	TRANSFAC	CGTCCGAAACGACCA	19	32.75	180	0.00123399