This page displays data from Segal et al. and was kindly provided to SGD by Eran Segal.

Module 9 (21 Genes) - Cell Cycle Analysis

Jump to: Significant GO annotations | Significant Motif Binding Sites.

Predicted Regulatory Module

The control program is a set of gene products predicted to regulate the cluster of genes below. The prediction is based on the relationship between the expression of the regulator and the expression of genes in the cluster as described in Segal et al. In several instances, there is direct experimental evidence to corroborate the predicted function of the regulators. In this view, the regulators (circled gene products) are in a hierarchy according to their effects on gene expression in the experiments directly below them.

Jump to: Predicted Control Program | Significant Motif Binding Sites.

Significant GO Annotations
This table lists, in order of significance, all GO annotations enriched in this cluster at a pvalue below 0.01. For each significant GO annotation, this table displays the following statistics: the number of genes in the cluster with the annotation (Hits), the percentage of genes in the cluster with the annotation (Hits (%)), the total number of genes in the entire dataset with the annotation (Total) and the pvalue of the annotation enrichment.
GO Term	Ontology	Hits	Hits (%)	Total	Pvalue
ethylene biosynthesis	Biological Process	6	28.57	9	1.22752e-09
ethylene metabolism	Biological Process	6	28.57	9	1.22752e-09
amino acid derivative biosynthesis	Biological Process	6	28.57	9	1.22752e-09
hormone biosynthesis	Biological Process	6	28.57	9	1.22752e-09
methionine metabolism	Biological Process	6	28.57	9	1.22752e-09
sulfur metabolism	Biological Process	8	38.09	28	5.81148e-09
response to wounding	Biological Process	6	28.57	12	1.2987e-08
response to pathogenic bacteria (incompatible interaction)	Biological Process	6	28.57	12	1.2987e-08
response to pathogenic fungi (incompatible interaction)	Biological Process	6	28.57	12	1.2987e-08
jasmonic acid/ethylene dependent systemic resistance	Biological Process	6	28.57	12	1.2987e-08
defense response	Biological Process	6	28.57	16	1.06841e-07
amino acid transport	Biological Process	3	14.28	8	0.000256852
sulfur amino acid metabolism	Biological Process	3	14.28	18	0.00320107
enzyme activity	Molecular Function	10	47.61	256	0.00543733
response to biotic stimulus	Biological Process	6	28.57	109	0.00762596
oxidoreductase activity	Molecular Function	3	14.28	27	0.00995686

Jump to: Predicted Control Program | Significant GO Annotations.

Significant Motif Binding Sites
This table lists, in order of significance, all motif binding sites enriched in this cluster at a pvalue below 0.01. For each significant motif binding site, the following statistics are displayed: the number of genes in the cluster with the binding site in their promoter (Hits), the percentage of genes with the binding site in their promoter (Hits (%)), the total number of genes in the dataset with the binding site in their promoter (Total) and the pvalue of the binding site enrichment. To view the sequence logo for each motif, click on the motif name.
Motif	Source	Consensus	Hits	Hits (%)	Total	Pvalue
GCN4_01	TRANSFAC	CCCGTGCCGATGACTCATCCCGCGCCC	13	61.90	214	1.59229e-05
CBF1_B	TRANSFAC	AGTCACGTGA	9	42.85	154	0.000844541