This page displays data from Segal et al. and was kindly provided to SGD by Eran Segal.

Module 16 (30 Genes) - Cell Cycle Analysis

Jump to: Significant GO annotations | Significant Motif Binding Sites.

Predicted Regulatory Module

The control program is a set of gene products predicted to regulate the cluster of genes below. The prediction is based on the relationship between the expression of the regulator and the expression of genes in the cluster as described in Segal et al. In several instances, there is direct experimental evidence to corroborate the predicted function of the regulators. In this view, the regulators (circled gene products) are in a hierarchy according to their effects on gene expression in the experiments directly below them.

Jump to: Predicted Control Program | Significant Motif Binding Sites.

Significant GO Annotations
This table lists, in order of significance, all GO annotations enriched in this cluster at a pvalue below 0.01. For each significant GO annotation, this table displays the following statistics: the number of genes in the cluster with the annotation (Hits), the percentage of genes in the cluster with the annotation (Hits (%)), the total number of genes in the entire dataset with the annotation (Total) and the pvalue of the annotation enrichment.
GO Term	Ontology	Hits	Hits (%)	Total	Pvalue
response to unfolded protein	Biological Process	3	10	3	1.51319e-05
receptor signaling protein activity	Molecular Function	9	30	77	5.73823e-05
signal transduction	Biological Process	9	30	80	7.78314e-05
osmosensory signaling pathway	Biological Process	4	13.33	11	9.8408e-05
MAPKKK cascade	Biological Process	4	13.33	11	9.8408e-05
two-component signal transduction system (phosphorelay)	Biological Process	4	13.33	13	0.000203779
osmosensory signaling pathway via two-component system	Biological Process	4	13.33	13	0.000203779
signal transducer activity	Molecular Function	10	33.33	122	0.00041057
transcription\, DNA-dependent	Biological Process	10	33.33	126	0.000531412
morphogenesis	Biological Process	6	20	46	0.000668495
cellular morphogenesis	Biological Process	6	20	50	0.00104041
regulation of transcription\, DNA-dependent	Biological Process	12	40	194	0.00122782
transcription	Biological Process	10	33.33	143	0.0014156
transcription from Pol II promoter	Biological Process	6	20	61	0.00286341
GTPase activator activity	Molecular Function	3	10	13	0.00342348
cell organization and biogenesis	Biological Process	7	23.33	88	0.00407583
regulation of transcription	Biological Process	5	16.66	47	0.00472288

Jump to: Predicted Control Program | Significant GO Annotations.

Significant Motif Binding Sites
This table lists, in order of significance, all motif binding sites enriched in this cluster at a pvalue below 0.01. For each significant motif binding site, the following statistics are displayed: the number of genes in the cluster with the binding site in their promoter (Hits), the percentage of genes with the binding site in their promoter (Hits (%)), the total number of genes in the dataset with the binding site in their promoter (Total) and the pvalue of the binding site enrichment. To view the sequence logo for each motif, click on the motif name.
Motif	Source	Consensus	Hits	Hits (%)	Total	Pvalue
FACBCA_Q2	TRANSFAC	CTCGCTCCCCTCCCGCGGGGAGCTAT	6	20	72	0.00911592