This page displays data from Segal et al. and was kindly provided to SGD by Eran Segal.

Module 19 (37 Genes) - Cell Cycle Analysis

Jump to: Significant GO annotations | Significant Motif Binding Sites.

Predicted Regulatory Module

The control program is a set of gene products predicted to regulate the cluster of genes below. The prediction is based on the relationship between the expression of the regulator and the expression of genes in the cluster as described in Segal et al. In several instances, there is direct experimental evidence to corroborate the predicted function of the regulators. In this view, the regulators (circled gene products) are in a hierarchy according to their effects on gene expression in the experiments directly below them.

Jump to: Predicted Control Program | Significant Motif Binding Sites.

Significant GO Annotations
This table lists, in order of significance, all GO annotations enriched in this cluster at a pvalue below 0.01. For each significant GO annotation, this table displays the following statistics: the number of genes in the cluster with the annotation (Hits), the percentage of genes in the cluster with the annotation (Hits (%)), the total number of genes in the entire dataset with the annotation (Total) and the pvalue of the annotation enrichment.
GO Term	Ontology	Hits	Hits (%)	Total	Pvalue
microtubule cytoskeleton	Cellular Component	5	13.51	16	7.63441e-05
cell	Cellular Component	31	83.78	633	8.97482e-05
initiation of viral infection	Biological Process	3	8.10	5	0.000273001
viral entry	Biological Process	3	8.10	5	0.000273001
virion penetration	Biological Process	3	8.10	5	0.000273001
endocytosis	Biological Process	3	8.10	6	0.000530107
cytoskeleton	Cellular Component	5	13.51	27	0.00103502
microtubule organizing center	Cellular Component	5	13.51	28	0.00122484
microtubule motor activity	Molecular Function	3	8.10	8	0.00139904
microtubule associated complex	Cellular Component	3	8.10	8	0.00139904
protein secretion	Biological Process	4	10.81	19	0.00211729
intracellular	Cellular Component	15	40.54	237	0.00219507
secretory pathway	Biological Process	4	10.81	20	0.00257093
motor activity	Molecular Function	3	8.10	10	0.00282543
microtubule-based process	Biological Process	4	10.81	22	0.0036625
spindle	Cellular Component	3	8.10	12	0.00488138
mitotic spindle assembly (sensu Fungi)	Biological Process	3	8.10	13	0.00615996
mitotic spindle positioning and orientation	Biological Process	3	8.10	13	0.00615996
mitotic spindle assembly (sensu Saccharomyces)	Biological Process	3	8.10	13	0.00615996
mitotic spindle positioning and orientation (sensu Fungi)	Biological Process	3	8.10	13	0.00615996
spindle pole body	Cellular Component	4	10.81	27	0.00759559
cytoskeleton organization and biogenesis	Biological Process	4	10.81	27	0.00759559
bud tip	Cellular Component	3	8.10	14	0.00761016
transcription regulator activity	Molecular Function	13	35.13	222	0.00857424
cytoplasm	Cellular Component	12	32.43	200	0.00970288

Jump to: Predicted Control Program | Significant GO Annotations.

Significant Motif Binding Sites
This table lists, in order of significance, all motif binding sites enriched in this cluster at a pvalue below 0.01. For each significant motif binding site, the following statistics are displayed: the number of genes in the cluster with the binding site in their promoter (Hits), the percentage of genes with the binding site in their promoter (Hits (%)), the total number of genes in the dataset with the binding site in their promoter (Total) and the pvalue of the binding site enrichment. To view the sequence logo for each motif, click on the motif name.
Motif	Source	Consensus	Hits	Hits (%)	Total	Pvalue
ABF1_01	TRANSFAC	CCATATCATTATATACGAAACT	17	45.94	200	7.06978e-05
ABF_C	TRANSFAC	TATCACTATAAACGA	18	48.64	241	0.000192969
STE11_01	TRANSFAC	AAGTTTCTTTGTTTTCTT	27	72.97	566	0.00274816
MAT1MC_01	TRANSFAC	AGACCTCTTTGTTGGTTA	20	54.05	351	0.00221088
TAF_Q6	TRANSFAC	CGTCCGAAACGACCA	12	32.43	187	0.00936098