Module 22 (38 Genes) - Cell Cycle Analysis |
| Jump to: Significant GO annotations | Significant Motif Binding Sites. |
| Predicted Regulatory Module | |||||
|---|---|---|---|---|---|
| The control program is a set of gene products predicted to regulate the cluster of genes below. The prediction is based on the relationship between the expression of the regulator and the expression of genes in the cluster as described in Segal et al. In several instances, there is direct experimental evidence to corroborate the predicted function of the regulators. In this view, the regulators (circled gene products) are in a hierarchy according to their effects on gene expression in the experiments directly below them. | |||||
![]() |
| Jump to: Predicted Control Program | Significant Motif Binding Sites. |
|   |
| Significant GO Annotations | |||||
|---|---|---|---|---|---|
| This table lists, in order of significance, all GO annotations enriched in this cluster at a pvalue below 0.01. For each significant GO annotation, this table displays the following statistics: the number of genes in the cluster with the annotation (Hits), the percentage of genes in the cluster with the annotation (Hits (%)), the total number of genes in the entire dataset with the annotation (Total) and the pvalue of the annotation enrichment. | |||||
| GO Term | Ontology | Hits | Hits (%) | Total | Pvalue |
| contractile ring (sensu Saccharomyces) | Cellular Component | 6 | 15.78 | 13 | 1.09117e-06 |
| bud | Cellular Component | 6 | 15.78 | 16 | 4.6819e-06 |
| bud neck | Cellular Component | 8 | 21.05 | 36 | 8.14165e-06 |
| site of polarized growth | Cellular Component | 9 | 23.68 | 55 | 2.82388e-05 |
| site of polarized growth (sensu Fungi) | Cellular Component | 9 | 23.68 | 55 | 2.82388e-05 |
| site of polarized growth (sensu Saccharomyces) | Cellular Component | 9 | 23.68 | 55 | 2.82388e-05 |
| cellular process | Biological Process | 21 | 55.26 | 333 | 0.000264546 |
| cell growth and/or maintenance | Biological Process | 20 | 52.63 | 333 | 0.000811528 |
| cell proliferation | Biological Process | 14 | 36.84 | 198 | 0.00150096 |
| axial budding | Biological Process | 3 | 7.89 | 11 | 0.00406581 |
| Jump to: Predicted Control Program | Significant GO Annotations. |
|   |
| Significant Motif Binding Sites | ||||||
|---|---|---|---|---|---|---|
| This table lists, in order of significance, all motif binding sites enriched in this cluster at a pvalue below 0.01. For each significant motif binding site, the following statistics are displayed: the number of genes in the cluster with the binding site in their promoter (Hits), the percentage of genes with the binding site in their promoter (Hits (%)), the total number of genes in the dataset with the binding site in their promoter (Total) and the pvalue of the binding site enrichment. To view the sequence logo for each motif, click on the motif name. | ||||||
| Motif | Source | Consensus | Hits | Hits (%) | Total | Pvalue |
| QA1F_01 | TRANSFAC | CCGGGTAAACGCTTATCCGC | 6 | 15.78 | 51 | 0.00658085 |
| MCM1_01 | TRANSFAC | TTTCCTAATCAGGTAA | 20 | 52.63 | 131 | 1.8555e-09 |
| MAT1MC_01 | TRANSFAC | AGACCTCTTTGTTGGTTA | 22 | 57.89 | 349 | 0.000425334 |