Predicted Regulatory Modules for Stress Analysis dataset

 Help
This analysis was performed according to Segal et al. on the pre-existing microarray dataset described above. A regulatory module is comprised of a set of genes predicted to regulate a cluster of genes and the cluster of genes regulated. The predictions are based on the co-expression of the regulators and those genes being regulated (see Segal et al.). For each module, the GO annotations (assigned by SGD) were analyzed to find common processes, functions, or cellular components shared by the gene products in a module (both regulators and regulatees). In addition, the upstream intergenic regions of each gene in a module were examined to find potential regulatory motifs.

For more information, see:
Segal E, Shapira M, Regev A, Pe'er D, Botstein D, Koller D, Friedman N., Module networks: identifying regulatory modules and their condition-specific regulators from gene expression data. Nat Genet. 2003.
These pages were kindly provided to SGD by Eran Segal.



More regulators, GO terms, motifs, binding factors, and regulated genes can be found on individual module pages. The module numbers (Module No.) in the table below correspond to the modules (separated by horizontal white lines) shown in the Bird's Eye View image on the left.

Bird's Eye View
(modules are in rows, colors are induced and repressed
cluster_649.html cluster_643.html cluster_637.html cluster_631.html cluster_625.html cluster_619.html cluster_613.html cluster_607.html cluster_601.html cluster_595.html cluster_589.html cluster_583.html cluster_577.html cluster_571.html cluster_565.html cluster_559.html cluster_553.html cluster_547.html cluster_541.html cluster_535.html cluster_529.html cluster_523.html cluster_517.html cluster_511.html cluster_505.html cluster_499.html cluster_493.html cluster_487.html cluster_481.html cluster_475.html cluster_469.html cluster_463.html cluster_457.html cluster_451.html cluster_445.html cluster_439.html cluster_433.html cluster_427.html cluster_421.html cluster_415.html cluster_409.html cluster_403.html cluster_397.html cluster_391.html cluster_385.html cluster_379.html cluster_373.html cluster_367.html cluster_361.html cluster_355.html
Module No. Top Regulator in Module Top Significant GO term for Regulated Genes in Module. Top Significant Motif Motif Binding Factor
1 GCN20 biological_process unknown tttcctaatcaggtaa MCM1_01
2 TOS8 peroxidase activity caggggc STRE_B
3 GCN20 cellular_component unknown
4 TPK1 transcription termination cgtccgaaacgacca TAF_Q6
5 PDR3 biological_process unknown agaacgttctagaac HSF_04
6 HAP4 inner membrane acccaccaatcacaga HAP234_01
7 XBP1 molecular_function unknown ctcgctcccctcccgcggggagctat FACBCA_Q2
8 PPT1 biological_process unknown caggggc STRE_B
9 CDC14 cell proliferation tttcctaatcaggtaa MCM1_01
10 YPK1 metallopeptidase activity agtcacgtga CBF1_B
11 PPH3 rRNA processing
12 TPK1 energy pathways tcaggggg STRE_01
13 APG1 protein targeting
14 YPL230W biological_process unknown caggggc STRE_B
15 XBP1 energy reserve metabolism caggggc STRE_B
16 GIS1 nucleobase\, nucleoside\, nucleotide and nucleic acid metabolism
17 GIS1 nucleus cgtccgaaacgacca TAF_Q6
18 GCN20 lipid biosynthesis cttcgag XBP1_Q2
19 YPL230W macromolecule biosynthesis atgaaac STE12_Q4
20 IME4 metabolism cgtccgaaacgacca TAF_Q6
21 RCS1 transcription regulator activity gtctcggaatactgcactccgg LAC9_C
22 PTC3 external encapsulating structure
23 GAT1 purine base metabolism cccgtgccgatgactcatcccgcgccc GCN4_01
24 SHP1 mitochondrion
25 XBP1 biological_process unknown caggggc STRE_B
26 YPL230W thiamin biosynthesis cggggt ADR1_01
27 FAR1 aldehyde metabolism agaacagaacgttct HSF_03
28 FKH1 mitochondrial translocation
29 XBP1 nucleosome cccgtgccgatgactcatcccgcgccc GCN4_01
30 YPL230W nuclear organization and biogenesis
31 APG1 transcription factor binding activity
32 GCN20 molecular_function unknown
33 HIR3 hexose catabolism catcggagcactgtcctccgaac GAL4_01
34 LSG1 nucleolus gttacccgg REB1_B
35 BMH1 protein folding cttcgag XBP1_Q2
36 PPT1 rRNA processing tcggagcactgtcctccgaacg GAL4_C
37 GAT1 heterocycle metabolism cccgtgccgatgactcatcccgcgccc GCN4_01
38 YPL230W molecular_function unknown
39 IME4 proteasome endopeptidase activity agaacagaacgttct HSF_03
40 YPL230W regulation of carbohydrate metabolism tactagccgccgagggc REPCAR1_01
41 GAT1 amino acid and derivative metabolism cccgtgccgatgactcatcccgcgccc GCN4_01
42 CDC14 transcription regulator activity
43 GCN20 protein metabolism tatcactataaacga ABF_C
44 HMLALPHA2 spliceosome complex
45 YPL230W RNA metabolism
46 TPK1 molecular_function unknown cccattgtt ROX1_Q6
47 GCN20 glycolysis ggcttcctc GCR1_01
48 YPL230W endoplasmic reticulum gttacccgg REB1_B
49 TPK1 response to drug caggggc STRE_B
50 WTM1 transport agaacagaacgttct HSF_03