---

• Site Map |
• Search Options |
• Help |
• Home |
•   |
•  

•  
• Community Info
• Submit Data
• BLAST
• Primers
• PatMatch
• Gene/Seq Resources
• Advanced Search
• Community Wiki

---

YAR044W Single Page Format

This page provides an alternative format to the SGD Locus Summary Page. Note that additional information may be available on or linked from the standard format SGD Locus Summary page.

Contents

Names and Identifiers GO Annotations Pathways Summary Paragraph Mutant Phenotypes Interactions Homologs Protein Info (physical properties, transcript info) PDB Homologs (protein structure info) Motifs Genome-wide Expression (and other large-scale analyses) Locus History (misc. notes) Sequence Retrieval and Analysis Map and Displays Localization Community Annotation Literature Guide

Sequence Coordinates   ChrI: 193600 to 196179 Click on map for expanded view SGD ORF map GBrowse

SGD Locus Page

Names and Identifiers [TOP] [NEXT]
Standard Name	Systematic Name	Alias	Feature Type	SGDID
	YAR044W		ORF, Merged	S000000082
Description
Merged open reading frame, does not encode a discrete protein; YAR044W was originally annotated as an independent ORF, but as a result of a sequence change, it was merged with an adjacent ORF into a single reading frame, designated YAR042W

GO Annotations [TOP] [NEXT]
No GO Annotations available.

Pathways [TOP] [NEXT]
No pathways available

Summary Paragraph [TOP] [NEXT]
No summary paragraph available

Basic References [TOP]

BASIC INFORMATION REFERENCES forYAR044W for YAR044W 1) Schmalix WA and Bandlow W (1994) SWH1 from yeast encodes a candidate nuclear factor containing ankyrin repeats and showing homology to mammalian oxysterol-binding protein. Biochim Biophys Acta 1219(1):205-10      2) Beh CT, et al. (2001) Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics 157(3):1117-40        3) Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            4) Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45      5) Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

Mutant Phenotypes [TOP] [NEXT]
Phenotype page for YAR044W

Interactions: genetic, physical, and other gene-gene links. [TOP] [NEXT]
Interaction page for YAR044W

Homologs [TOP] [NEXT]

Physical Properties and Transcript Information: predicted from sequence [TOP] [NEXT]
No protein information available.

Protein Structures from PDB: proteins of known structure with sequence similarity to YAR044W, based on Smith-Waterman analysis. [TOP] [NEXT]
No protein structure information available.

Genome-wide Expression and Other Large-Scale Analyses [TOP] [NEXT]
	You can also search multiple datasets simultaneously using Expression Connection for expression studies or Function Junction for other large scale analyses.

Locus History (misc. notes) [TOP] [NEXT]

Sequence Annotation Notes

Date	Note
2001-04-10	April 10, 2001: SWH1/YAR042W and OSH1/YAR044W are actually not two separate genes and should be combined (see the references below). However, this requires sequence verification in S288C. As advised by Dr. Howard Bussey, SGD contacted MIPS on April 5, 2001 about their quality control data on chromosome I. References: Schmalix et al. 1994 Biochimica et Biophysica Acta 1219, 205-210. Beh et al. 2001 Genetics 157: 1117-1140 Christopher Beh, UC Berkeley, Personal Communication April 19, 2001: SGD received a reply from MIPS saying that they do not have any quality control data on Chromosome I; MIPS would stay with two ORFs (YAR042W and YAR044W) for now. MIPS also said that the sequence should be verified in S288C before these two ORFs can be combined.
2003-09-27	Insertion of a single G after the G at 193300 merged SWH1/YAR042W and OSH1/YAR044W. After merging YAR042W (coordinates 192613-193383 (1-771)) and YAR044W (coordinates 193599-196178 (1-2580)), the coordinates of the merged ORF, SWH1/YAR042W, are 192613-196179 (1-3567). OSH1 and YAR044W are now aliases of SWH1/YAR042W. This sequence change was predicted by several studies, then verified in S288c by SGD. Old: 193261 CTTGAACACGGTGCTGACCCCTTCAAGAGAGACCGCAAGG-CAAACTGCCCATCGAGCTC 193319 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| New: 193261 CTTGAACACGGTGCTGACCCCTTCAAGAGAGACCGCAAGGGCAAACTGCCCATCGAGCTC 193320 Schmalix WA and Bandlow W (1994) SWH1 from yeast encodes a candidate nuclear factor containing ankyrin repeats and showing homology to mammalian oxysterol-binding protein. Biochim Biophys Acta 1219(1):205-10      Beh CT, et al. (2001) Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics 157(3):1117-40        Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45      Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

Sequence Retrieval [TOP] [NEXT]
No sequence data available.

Map and Displays [TOP] [NEXT]
No Map and Display available.

Localization [TOP] [NEXT]

Community Annotation [TOP] [NEXT]
No community annotation available.

Literature Guide: papers categorized by topic. [TOP]
Topics	Reference	Other Genes Addressed
0 curated references; 0 references not yet curated

Return to SGD

Send a Message to the SGD Curators