SGD Paper 
Sor F and Fukuhara H (1982) Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast. Nucleic Acids Res 10(5):1625-33
Abstract: The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.FAU - Sor, .
| Status: Published | Type: Journal Article | PubMed ID: 6280154 |
Topics addressed in this paper
- To find other papers on a gene and topic, click on the colored ball in the appropriate box.
- displays other papers with information about that topic for that gene.
- displays other papers in SGD that are associated with that topic.
The topic is addressed in these papers but does not describe a specific gene or chromosomal feature.
- To go to the Locus page for a gene, click on the gene name.
| Topics | Genes linked to topics |
|---|---|
| 15S_RRNA | |
| Additional Literature |  |
| DNA/RNA Sequence Features | |
| Fungal Related Genes/Proteins | |
