tW(CCA)G1 Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ARS714 and tRNA-Trp tW(CCA)G1.
New    286305   CACCATTAACTTTACAACATTACATAATATGACATTCCACAGAACCTCTCTATTCCATTT  286364
                ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    286311   CACCATTAACTTTACAACATTACATAATATGACATTCCACAGAAC-TCTCTATTCCATTT  286369
New    286675   TGCATTTATCTCAGGATATAATGATCCCGTTATCCAATCGATATAGCTT-CCTCAGGTTT  286733
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    286680   TGCATTTATCTCAGGATATAATGATCCCGTTATCCAATCGATATAGCTTTCCTCAGGTTT  286739
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()