tT(UGU)G2 Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region between ORF COQ6/YGR255C and tRNA-Thr tT(UGU)G2.
New    1004007  AGTTACTGAATGAAGAAAATTAT-CGCCACAATTATATTTATTCCTTTTTAATGTCGTAT  1004065
                ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old    1004012  AGTTACTGAATGAAGAAAATTATCCGCCACAATTATATTTATTCCTTTTTAATGTCGTAT  1004071
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide deletion and a single nucleotide insertion were made in the intergenic region between tRNA-Thr tT(UGU)G2 and ORF GND2/YGR256W.
New    1004306  AGTATTAATAATTGAGGCGCCCCTAA-TTTTTTTGGCACCGCTCTCGATGAAAAAGTAGA  1004364
                |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old    1004312  AGTATTAATAATTGAGGCGCCCCTAATTTTTTTTGGCACCGCTCTCGATGAAAAAGTAGA  1004371
New    1004495  GGAGTTAGCTCAAATATATATATATATATATATATGGAGACAACGTTTGAAGAATTCGTA  1004554
                ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    1004502  GGAGTTAGCTCAAATATATATATATATATATATATGGAGACAACG-TTGAAGAATTCGTA  1004560
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()