tS(GCU)F Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made within the intergenic region between ORF FAB1/YFR019W and tRNA tS(GCU)F.
New    191390  CGCACATTAGTGTTCTTTAACTTTCAGTACCTTAGTAGTTATCAACTATGAAAAGGTGGT  191449
               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    191378  CGCACATTAGGGTTCTTTAACTTTCAGTACCTTAGTAGTTATCAACTATGAAAAGGTGGT  191437
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()