SUP56/tL(CAA)A Locus History Help


Nomenclature History
Standard Name Reference
SUP56 Liebman SW, et al.  (1984) Yeast amber suppressors corresponding to tRNA3Leu genes. J Mol Biol 178(2):209-26
Sequence Annotation Notes
DateNote
2011-02-03A tetranucleotide insertion was made in the intergenic region between ORF YAR023C and tRNA-Leu SUP56/tL(CAA)A.
New    180942  TTCCCATTACAATGCCGAATAGCAAAATATGTAGTAGAACACGTACACGCATGATAATTA  181001
               ||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||
Old    180940  TTCCCATTACAATGCCGAATAG----ATATGTAGTAGAACACGTACACGCATGATAATTA  180995
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()