tK(CUU)G1 Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region bewteen tRNA-Lys tK(CUU)G1 and ORF EMP24/YGL200C.
New    122520   ACCATATATATGTATATATTTATTTACATGTAATTGGCACAGGG-AAAAACAGTGGAAGG  122578
                |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    122524   ACCATATATATGTATATATTTATTTACATGTAATTGGCACAGGGGAAAAACAGTGGAAGG  122583
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()