tE(UUC)G2 Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ORF ERV14/YGL054C and tRNA-Glu tE(UUC)G2.
New    401378   TGAGAAAAATCCAGGTCTCTCCTTCGTATTAAGGAATACATGATCTA-GCTATCACTCTT  401436
                |||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||
Old    401381   TGAGAAAAATCCAGGTCTCTCCTTCGTATTAAGGAATACATG-TCTATGCTATCACTCTT  401439
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()