SNR47/snR47 Locus History Help


Nomenclature History
Standard Name Reference
SNR47 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2001-03-09Changed from W -> C: old start coord: 541641; old stop coord: 541701 new start coord: 541739; new stop coord: 541641 References: 1. Ni et al. (1996) Cell 86(5):823-834 2. snoRNA database: http://www.bio.umass.edu/biochem/rna-sequence/Yeast_snoRNA_Database/snoRNA_DataBase.html 3. Personal communication: Dr. Eric Steinmetz Dept. of Biomolecular Chemistry University of Wisconsin 1300 University Ave. Madison, WI 53706
2007-04-04The coordinates of both the 5' and 3' ends of snR47 were shifted 47 nucleotides towards the left end of the chromosome to match those given in the yeast snoRNA database at UMass Amherst and as reported in Balakin AG et al. (1996) and the corresponding GenBank entry U56648. Thanks to Jason Hoskins for reporting this discrepancy and to Wayne Decatur for providing additional confirmation.

Balakin AG, et al.  (1996) The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86(5):823-34
2011-02-03A single nucleotide deletion was made in the intergenic region between snoRNA SNR47 and ORF NRG1/YDR043C.
New    541986   AATAATTAACTATACTATTGTTCGGAGACAGTTCTGATGCCTAGTAAAA-CGCTTGCAGC  542044
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    541984   AATAATTAACTATACTATTGTTCGGAGACAGTTCTGATGCCTAGTAAAAACGCTTGCAGC  542043
Dietrich F  (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. ()