SNR43/snR43 Locus History Help


Nomenclature History
Standard Name Reference
SNR43 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2000-09-13The systematic sequence was updated in the region encompassing feature snR43. Note that coordinates listed are chromosomal coordinates.
Old:   107467 TTTAAAGTAATTTCTTCTTTTTTTATAGTGAGAAATCTCAAAAGAAAAAAAAAAAA-TAA 107525
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   107852 TTTAAAGTAATTTCTTCTTTTTTTATAGTGAGAAATCTCAAAAGAAAAAAAAAAAAATAA 107911
Old:   107586 TCAGCAACTTGTAGGAGGAGAAAGCAG-TATATAACTAGCCGCAATATGTTTGTGGTGGA 107644
              ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   107972 TCAGCAACT-GTAGGAGGAGAAAGCAGGTATATAACTAGCCGCAATATGTTTGTGGTGGA 108030