- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Wiki
| Nomenclature History | |
|---|---|
| Standard Name | Reference |
| SNR17A | Hughes JM, et al. (1987) The yeast homologue of U3 snRNA. EMBO J 6(7):2145-55 |
| Other Name(s) | Reference |
|---|---|
| U3 | Hughes JM, et al. (1987) The yeast homologue of U3 snRNA. EMBO J 6(7):2145-55 |
| Other Notes | |
|---|---|
| Date | Note |
| 2007-06-01 | Please note that in the UMass snoRNA database, the sequence listed for the U3a snoRNA (snR17a) differs from that listed in SGD at one nucleotide. SGD lists a C at relative position 357, while UMass currently lists this nucleotide as a G. The UMass numbering below reflects relative coding coordinates with the intron removed; SGD numbering below reflects relative coding coordinates before the removal of the intron.
SGD: 292 attagcttggtccgcaatccttagcggttcggccatctataattttgaataaaaattttg 351
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
UMass: 135 attagcttggtccgcaatccttagcggttcggccatctataattttgaataaaaattttg 194
SGD: 352 ctttgccgttgcatttgtagttttttcctttggaagtaattacaatattttatggcgcga 411
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
UMass: 195 ctttggcgttgcatttgtagttttttcctttggaagtaattacaatattttatggcgcga 254
SGD: 412 tgatcttgacccatcctatgtacttcttttttgaagggatagggctctatgggtgggtac 471
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
UMass: 255 tgatcttgacccatcctatgtacttcttttttgaagggatagggctctatgggtgggtac 314
The SGD reference sequence is based on that received from the European yeast chromosome XV sequencing project, based on S288C substrain FY1679, as listed in GenBank records Z75144 and Z75143. The SGD sequence also matches GenBank records M18578 from strain JRY117 (Bachellerie 1989) and X05499 from strain BY4743 (Hughes et al. 1987). The UMass record matches GenBank record M26648 from strain BY4741 (Myslinski et al. 1990). |
| Bachellerie JP (1989) U3 small nuclear RNA (snR17A RNA) and DFR1 genes are very closely linked in Saccharomyces cerevisiae. Gene 84(1):207-8 | |
| Hughes JM, et al. (1987) The yeast homologue of U3 snRNA. EMBO J 6(7):2145-55 | |
| Myslinski E, et al. (1990) An intron in the genes for U3 small nucleolar RNAs of the yeast Saccharomyces cerevisiae. Science 247(4947):1213-6 | |
| Mapping Notes | |
|---|---|
| Date | Note |
| 1992-10-01 | Edition 11: snR17a is adjacent to dfr1; the 3' end of snR17a is 311 bp from the 5' end of dfr1 |
| Mortimer RK, et al. (1992) Genetic and physical maps of Saccharomyces cerevisiae, Edition 11. Yeast 8(10):817-902 | |
| 1998-11-10 | Edition 15: In the past this locus was incorectly identified as another name for the YOR235W locus, which snr17a overlaps. snr17a encodes the untranslated U3 small nuclear RNA gene, and YOR235W is a predicted open reading frame (ORF) of 104 amino acids for which there is presently no experimental evidence. |
| Cherry JM, et al. (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America | |




