YPRWdelta16 Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03Two single nucleotide insertions were made in the intergenic region between YPRWdelta16 and YPR121W/THI22.
New    778258  TTAATGGAATAACGTGATTTTTGTACCAAATTGCCTATTTCAGATTCGGCGTGCGCTTCC  778317
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    778256  TTAATGGAATAACGTGATTTTTGTACCAAATTGCCTATTTCAGATTC-GCGTGCGCTTCC  778314
New    778368  TGCACGGAAGATCCTTGCAGGAATCAAATACTGCCTTTCACTTTGCAACCTCTTAATCACATAGTAGCAC  778437
               |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    778365  TGCACGGAAGAT-CTTGCAGGAATCAAATACTGCCTTTCACTTTGCAACCTCTTAATCACATAGTAGCAC  778433
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()