BDS1/YOL164W Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2005-08-10.
Standard Name Reference
BDS1 Hall C, et al.  (2005) Contribution of horizontal gene transfer to the evolution of Saccharomyces cerevisiae. Eukaryot Cell 4(6):1102-15
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs BDS1/YOL164W and YOL163W.
New    8461     AGAGCTTTTCGTATATTCTGTTTTCCTAATAACATTTACTATTGTGAATTGAAATTTAAA  8520
                |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    8461     AGAGCTTTTCGTATAT-CTGTTTTCCTAATAACATTTACTATTGTGAATTGAAATTTAAA  8519
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()