YPT11/YNL304W Locus History Help


Nomenclature History
Standard Name Reference
YPT11 Lazar T, et al.  (1997) Vesicular transport: how many Ypt/Rab-GTPases make a eukaryotic cell? Trends Biochem Sci 22(12):468-72
Nomenclature History Notes
DateNote
2003-12-09Both YPT32/YGL210W, a GTPase involved in exocytosis and vesicle-mediated transport, and YPT11/YNL304W, a RAB small monomeric GTPase involved in mitochondrial inheritance, have been referred to as YPT11.
Sequence Annotation Notes
DateNote
2003-12-01Based on the automated comparison of closely related Saccharomyces species, Kellis et al. and Cliften et al. suggest that the start site for YPT11/YNL304W be moved 185 nt upstream. This suggestion was reviewed by SGD curators, but will not be incorporated until supported by experimental data. The reason(s) for this decision are as follows: 1) translation of YNL304W sequence plus 185 nt upstream results in a premature stop 2) The proposed start at 60297 is conserved in Saccharomyces sensu stricto strains as well as S. castellii and S. kluyveri, however S. cerevisiae sequence has a potential deletion at about -78, a region that is conserved among other Saccharomyces strains 3) sequencing of the region in S288C will be required to resolve this proposal.

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2005-11-07Based on the automated comparison of closely related Saccharomyces species, Kellis et al. and Cliften et al. suggested that the start site for YPT11/YNL304W be moved 185 nt upstream. This change required a sequencing error in the reference strain. SGD confirmed a sequencing error in this position, and the systematic sequence has been updated accordingly. As a consequence of this sequence change, YPT11/YN304W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 355 to 417 amino acids.
New: 60367 CACCGATACGGACTAACGAATCCAATTGGGAAGCTGCTTCGCCAGCGAGTGCTGCATCTT 60426
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old: 60367 CACCGATACGGACTAACGAATCCAATTGGGAAGCTG-TTCGCCAGCGAGTGCTGCATCTT 60425
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
Cliften P, et al.  (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
Mapping Notes
DateNote
1998-11-10Edition 15: YPT32 has also been called YPT11 (MIPS); do not confuse YPT11/YNL304W with YPT32/YGL210W on chromosome VII

Cherry JM, et al.  (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America