RPL40B/YKR094C Locus History Help


Nomenclature History
Standard Name Reference
RPL40B SGD  (2007) Information without a citation in SGD ()
Other Name(s)Reference
L40B Planta RJ and Mager WH  (1998) The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14(5):471-7
L40e Jenner L, et al.  (2012) Crystal structure of the 80S yeast ribosome. Curr Opin Struct Biol 22(6):759-67
UBI2 Ozkaynak E, et al.  (1987) The yeast ubiquitin genes: a family of natural gene fusions. EMBO J 6(5):1429-39
Sequence Annotation Notes
DateNote
2011-02-03A dinucleotide substitution was made within the intron of ORF RPL40B/YKR094C.
New    618574  TAAACTCAGAAGCTTGCCGCAGGTAATAGTTTTTCTCAATTGCTACTTGTTTAATAAATT  618633
               ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||
Old    618216  TAAACTCAGAAGCTTGCCGCGAGTAATAGTTTTTCTCAATTGCTACTTGTTTAATAAATT  618275
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()