AVT1/YJR001W Locus History Help


Nomenclature History
Standard Name Reference
AVT1 Russnak R, et al.  (2001) A family of yeast proteins mediating bidirectional vacuolar amino acid transport. J Biol Chem 276(26):23849-57
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs AVT1/YJR001W and MPP10/YJR002W.
New    438599  ATTATTTCATAATCGACGAGGGGCATACTTACTCTACTTAAAATTCATTTACATTAGCTC  438658
               |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    438592  ATTATTTCATAATCGACGAGGGGCATACTTACTCTACTTAAA-TTCATTTACATTAGCTC  438650
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()