YJLWtau4 Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made within Ty4 LTR YJLWtau4.
New    422260  TCATTAATAAAGC-TTTTTGACCTCTACCTATGAGCAATAAACCATATCCATCAATAGTG  422318
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old    422253  TCATTAATAAAGCCTTTTTGACCTCTACCTATGAGCAATAAACCATATCCATCAATAGTG  422312
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03A single nucleotide substitution and a single nucleotide insertion were made in the intergenic region between Ty4 LTR YJLWtau4 and Ty1 LTR YJLWdelta10.
New    422439  CAGTAAAATACTACGCGCCTAGTATAATGACTTCTATATCCAAAATTTTTAAGTTAACCT  422498
               ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||
Old    422433  CAGTAAAATACTACGGGC-TAGTATAATGACTTCTATATCCAAAATTTTTAAGTTAACCT  422491
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()