SWE1/YJL187C Locus History Help


Nomenclature History
Standard Name Reference
SWE1 Booher RN, et al.  (1993) Properties of Saccharomyces cerevisiae wee1 and its differential regulation of p34CDC28 in response to G1 and G2 cyclins. EMBO J 12(9):3417-26
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs SWE1/YJL187C and MNN5/YJL186W.
New    79321   AGTAAGACCTGTTCAGTAGTAATCCTTTTTTTATTGGACTAACTGCGCAAGATGATGTGC  79380
               ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    79320   AGTAAGACCTGTTCAGTAGTAATCCTTTTTT-ATTGGACTAACTGCGCAAGATGATGTGC  79378
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()