YJL169W Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03Nucleotide changes within the coding regions of overlapping ORFs YJL169W and/or SET2/YJL168C resulted in altered protein sequences for both ORFs. The start, stop, and reading frame of YJL169W remain the same, but protein residue 62 is now Alanine rather than Proline. The start, stop, and reading frame of SET2/YJL168C also remain the same, but protein residue 594 is now Alanine rather than Phenylalanine, residue 605 is now Alanine rather than Serine, and residue 716 is now Alanine rather than Glycine.
New    102237  GTTGAAGGTGGAGGAGAAGACATCCTTGTTGATGCTGATGATAATGCCAACGCCTTTTTT  102296
               ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    102231  GTTGAAGGTGGAGGAGAAGACATCCTTGTTGATGCTGATGATAATCCCAACGCCTTTTTT  102290
New    102597  GCTTCCACTAGTTTTTTGGCCTCTTCCTTTTGTAACTCCTTCTGTTTGTTGGCCTCCGCT  102656
               ||||||||||||||||||| |||||||||||||||||||||||||||||||  |||||||
Old    102591  GCTTCCACTAGTTTTTTGGACTCTTCCTTTTGTAACTCCTTCTGTTTGTTGAACTCCGCT  102650