JJJ2/YJL162C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2004-06-10.
Standard Name Reference
JJJ2 Walsh P, et al.  (2004) The J-protein family: modulating protein assembly, disassembly and translocation. EMBO Rep 5(6):567-71
Sequence Annotation Notes
DateNote
2003-12-01Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the stop site for YJL162C be moved 303 nt downstream. This suggestion was reviewed by SGD curators, but will not be incorporated until supported by experimental data. The reason(s) for this decision are as follows: Although the proposed stop codon is present, in frame, in S. cerevisiae a sequence error would be required in order for the translation frame to extend past the currently annotated stop codon. Proposed S. cerevisiae sequencing error(s) must be confirmed in S288C before the annotation is changed.

Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2006-01-18SGD confirmed the sequence error suggested by Kellis et al and has updated the sequence accordingly. As a consequence of this change, JJJ2/YJL162C has been extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 482 to 583 amino acids.
(1) Substitute A for the T at 114177
New: 114156 ATCTCTGGTATTTCCAAATCTAAGATCTCGGGTGTAAT 114193
            ||||||||||||||||||||| ||||||||||||||||
Old: 114156 ATCTCTGGTATTTCCAAATCTTAGATCTCGGGTGTAAT 114193

AND

(2) Substitute C for the G at 114328
New: 114311 TAACGAGTCATTAATTGCATCCATCATAAAATAATC 114346
            ||||||||||||||||| ||||||||||||||||||
Old: 114311 TAACGAGTCATTAATTGGATCCATCATAAAATAATC 114346
Kellis M, et al.  (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2011-02-03A single nucleotide substitution was made in the intergenic region between ARS1007 and ORF JJJ2/YJL162C.
New    113814  ATTCAAATTATTTCCATCCTGGCGTAAGGACGACGGGTATATGCTCATTAAGAAGAGCGT  113873
               |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Old    113810  ATTCAAATTATTTCCATCCTGGCGTAAGGACGGCGGGTATATGCTCATTAAGAAGAGCGT  113869
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()