YJL113W Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03Two separate single nucleotide deletions were made within retrotransposon YJLWTy4-1, affecting Gag and Pol ORFs YJL114W and YJL113W.
New    198581  AAAAACAAA-TATAGAAGTTTGCATGGTAGAGATGTCAGAATTAGAGCCTGGG-AAAAGG  198639
               ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||
Old    198579  AAAAACAAAATATAGAAGTTTGCATGGTAGAGATGTCAGAATTAGAGCCTGGGGAAAAGG  198638
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Other Notes
DateNote
2000-08-17Gag processing produces capsid proteins. Pol is cleaved to produce protease, reverse transcriptase and integrase activities.