ALY2/YJL084C Locus History Help


Nomenclature History
An SGD Standard Name was first assigned to this gene on 2007-09-04.
Standard Name Reference
ALY2 O' Donnell A  (2006) personal communication Gupta R, et al.  (2007) Ubiquitination screen using protein microarrays for comprehensive identification of Rsp5 substrates in yeast. Mol Syst Biol 3:116
Other Name(s)Reference
ART3 Lin CH, et al.  (2008) Arrestin-related ubiquitin-ligase adaptors regulate endocytosis and protein turnover at the cell surface. Cell 135(4):714-25
Sequence Annotation Notes
DateNote
1997-07-27The two CC nucleotides at chromosomal coordinates 275144-275145 within the ORF YJL084C were changed to GG.
New: 275101 AAGTTCGTCTTCTATTAAAACTTGATTTAAATCTGTGAAAAAAGGATTATCGTGTCTTAT 275160
            |||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||
Old: 275101 AAGTTCGTCTTCTATTAAAACTTGATTTAAATCTGTGAAAAAACCATTATCGTGTCTTAT 275160