- Summary
- Locus History
- Literature
- Gene Ontology
- Phenotype
- Interactions
- Expression
- Protein
- Wiki
| Sequence Annotation Notes | |
|---|---|
| Date | Note |
| 2003-07-29 | Thanks to MIPS for providing the coordinates for the following Chromosome VIII ORFs: YHL002C-A, YHL006W-A, YHL019W-A, YHL030W-A, YHL034W-A, YHL046W-A, YHR028W-A, YHR032C-A, YHR056W-A, YHR063W-A, YHR069C-A, YHR070C-A, YHR071C-A, YHR131W-A, YHR165W-A, YHR182C-A, YHR193C-A, and YHR218W-A. |
| 2004-02-01 | Based on the automated comparison of related fungi, Cliften et al. and Brachat et al. both suggest that the start site for RSC30/YHR056C be moved 155 nt upstream. Based on experimental evidence, Angus-Hill et al. proposed the deletion of a single T nt upstream of RSC30/YHR056C, allowing a 51 amino acid N-terminal extension. This sequence change was confirmed in S288c by SGD. As a consequence of this sequence change, two ORFs were extended: (1) RSC30/YHR056C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 832 to 883 amino acids; (2) YHR056W-A was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 143 to 144 amino acids.
New: 217704 AAAACAGTCCGGCTTGTTATACTTGACGCAATTCCCACATATCGGTTT-GGCCCTGTCGC 217762
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old: 217704 AAAACAGTCCGGCTTGTTATACTTGACGCAATTCCCACATATCGGTTTTGGCCCTGTCGC 217763 |
| Angus-Hill ML, et al. (2001) A Rsc3/Rsc30 zinc cluster dimer reveals novel roles for the chromatin remodeler RSC in gene expression and cell cycle control. Mol Cell 7(4):741-51 | |
| Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | |
| Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2011-02-03 | A single nucleotide substitution within the coding region of YHR056W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 116 is now Cysteine rather than Glycine. This nucleotide change also altered the DNA sequence, but not the amino acid sequence, of overlapping ORF RSC30/YHR056C.
New 217731 CAATTCCCACATATCGGTTTTGCCCTGTCGCACCCGATCTTTCTCTTCCTGCATTGGGTG 217790
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old 217733 CAATTCCCACATATCGGTTTGGCCCTGTCGCACCCGATCTTTCTCTTCCTGCATTGGGTG 217792
|
| Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. () | |




