ARD1/YHR013C Locus History Help


Nomenclature History
Standard Name Reference
ARD1 Whiteway M and Szostak JW  (1985) The ARD1 gene of yeast functions in the switch between the mitotic cell cycle and alternative developmental pathways. Cell 43(2 Pt 1):483-92
Other Name(s)Reference
NAA10 Polevoda B, et al.  (2009) A synopsis of eukaryotic Nalpha-terminal acetyltransferases: nomenclature, subunits and substrates. BMC Proc 3 Suppl 6:S2
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs ARD1/YHR013C and SPO13/YHR014W.
New    131450  TGACGAAGTTTTATTTTGGAGCTTGATCGTATGTATTTAGGTTTCCCTTTTCACTTGGCAATTACTCGTT  131519
               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    131444  TGACGAAGTTT-ATTTTGGAGCTTGATCGTATGTATTTAGGTTTCCCTTTTCACTTGGCAATTACTCGTT  131512
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
Mapping Notes
DateNote
1998-11-10Edition 15: 10 ard1 is proximal to arg4; data in 1985 mapping review

Cherry JM, et al.  (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America