YGR226C Feature History Help

Sequence Annotation Notes
DateNote
2005-11-29Based on the automated comparison of related fungi, Brachat et al. (2003) suggest that the C-terminus of Ama1p/YGR225Wp be extended 31 amino acids. SGD has confirmed the insertion of a T after the T at 946899 and is supported by Cooper, et al (2000). As a consequence, YGR225W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 562 amino acids to 593 amino acids. In addition, YGR226C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 199 amino acids to 69 amino acids.
New:        ACTAACGATGAAACGATAAGATTTTATGAACTGTGGAACGATAAGGAGGAAATAATTAAT
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old: 946876 ACTAACGATGAAACGATAAGATTT-ATGAACTGTGGAACGATAAGGAGGAAATAATTAAT 946934
Cooper KF, et al.  (2000) Ama1p is a meiosis-specific regulator of the anaphase promoting complex/cyclosome in yeast. Proc Natl Acad Sci U S A 97(26):14548-53
Brachat S, et al.  (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45