ERG25/YGR060W Locus History Help


Nomenclature History
Standard Name Reference
ERG25 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between snoRNA SNR48 and ORF ERG25/YGR060W.
New    610052   ACGGCCACTGCCACTACCACTGCCTCCCTTCGTATACGGGACACAGAGATCGTATACGGT  610111
                ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old    610056   ACGGCCACTGCCACTACCACTGCCTCCCTTCGTATACGGAACACAGAGATCGTATACGGT  610115
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()