ERG25/YGR060W Locus History Help


Nomenclature History
Standard Name Reference
ERG25 Bard M, et al.  (1996) Cloning and characterization of ERG25, the Saccharomyces cerevisiae gene encoding C-4 sterol methyl oxidase. Proc Natl Acad Sci U S A 93(1):186-90
Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide substitution was made in the intergenic region between snoRNA SNR48 and ORF ERG25/YGR060W.
New    610052   ACGGCCACTGCCACTACCACTGCCTCCCTTCGTATACGGGACACAGAGATCGTATACGGT  610111
                ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old    610056   ACGGCCACTGCCACTACCACTGCCTCCCTTCGTATACGGAACACAGAGATCGTATACGGT  610115
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()