YGLWdelta10 Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between tRNA-Val tV(AAC)G1 and Ty1 LTR YGLWdelta10.
New    412357   ACCACGAAACCAGTTTTTTGATGTTTCGTTTAGGGACAAGAGTCCTATGAGAGTCCACTA  412416
                |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old    412360   ACCACGAAACCAGTTTTTTGATGTTTCGTTTAGG-ACAAGAGTCCTATGAGAGTCCACTA  412418
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()
2011-02-03Several nucleotide sequence changes were made in the intergenic region between Ty1 LTR YGLWdelta10 and ORF RIM8/YGL045W.
New    413077   TCTACAGCCG-ACGGGCACTCTATGTATACTCATATCACAGCCACTGTTGCACTACATTA  413135
                |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    413079   TCTACAGCCGGACGGGCACTCTATGTATACTCATATCACAGCCACTGTTGCACTACATTA  413138
New    413316   TCGCACGGGTCTTCTGTGCGAATGAGCCACAACGGGGCCGAGTTCAGCGCGTGTCCGCCT  413375
                |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||
Old    413319   TCGCACGGGTCTTCTGTGCGAATGAGCCACAACGGGGCCGAGTTCAGGCCGTGTCCGCCT  413378
New    413376   ACAACGTCCGCCAACTAGTGGCAATTGCTAGGCTACGCCGACCACGCTGACACGCACCGT  413435
                |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||
Old    413379   ACAACGTCCGCCAACTAGTGGCAATTGCTACG-TACGCCGACCACGCTGACACGCACCGT  413437
New    413736   CTTAATCGCCTTTCTTTGTTTTCTTTCTTCGTTATTTGTTCTTGGA-CTTTTCCGCTCCA  413794
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    413738   CTTAATCGCCTTTCTTTGTTTTCTTTCTTCGTTATTTGTTCTTGGAACTTTTCCGCTCCA  413797
New    413925   TGTCTAAGCTCTATTGAGTCAAAAGTAACAATCTAGACGAAG-AAAAAAAAAAAATAGAA  413983
                |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    413928   TGTCTAAGCTCTATTGAGTCAAAAGTAACAATCTAGACGAAGGAAAAAAAAAAAATAGAA  413987
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()