YGL214W Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single T nucleotide was inserted within ORF YGL214W very near its 5' end, altering its coding sequence. The reading frame and stop remain the same, but the start has been shifted downstream four nucleotides and the annotated protein is now one amino acid shorter.
New    89994    CCAAAAAGAATAATGGATGATTGTAAGGTTACATGCAATATATCAAGATATTACTAGAGA  90053
                ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Old    89999    CCAAAAAGAATAATGGATGAT-GTAAGGTTACATGCAATATATCAAGATATTACTAGAGA  90057
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()