SKI8/YGL213C Locus History Help


Nomenclature History
Standard Name Reference
SKI8 Ridley SP, et al.  (1984) Superkiller mutations in Saccharomyces cerevisiae suppress exclusion of M2 double-stranded RNA by L-A-HN and confer cold sensitivity in the presence of M and L-A-HN. Mol Cell Biol 4(4):761-70
Other Name(s)Reference
REC103 Gardiner JM, et al.  (1997) Molecular and genetic analysis of REC103, an early meiotic recombination gene in yeast. Genetics 146(4):1265-74
Sequence Annotation Notes
DateNote
2011-02-03Several nucleotide sequence changes were made in the intergenic region between ORFs CLG1/YGL215W and SKI8/YGL213C.
New    89571    AAAGATTATTATTATTA----CTTTTTTTATTAGTACTCCA-TATGGACCTCTTAGGTGA  89625
                |||||||||||||||||    ||||||||||| |||||||| ||||||||||||||||||
Old    89570    AAAGATTATTATTATTAGTTACTTTTTTTATT-GTACTCCAGTATGGACCTCTTAGGTGA  89628
New    89706    GGAATAAAAACTATAAAAAATGAAAACCAAAAAAAAAAAG-C-ACTGGATTTTTAACATC  89763
                |||||||||||||||||||||||||| ||||||||||||| | |||||||||||||||||
Old    89709    GGAATAAAAACTATAAAAAATGAAAAGCAAAAAAAAAAAGGCTACTGGATTTTTAACATC  89768
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()