PYC1/YGL062W Locus History Help


Nomenclature History
Standard Name Reference
PYC1 SGD  (2007) Information without a citation in SGD ()
Sequence Annotation Notes
DateNote
2011-02-03A dinucleotide substitution was made in the intergenic region between ORFs PUS2/YGL063W and PYC1/YGL062W.
New    384824   GGCTATTCAACTTAGACAAGCGCCAGTTGCGCGCACAAATTTGGTCATGACCGCTCCACC  384883
                |||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||
Old    384827   GGCTATTCAACTTAGACAACGGCCAGTTGCGCGCACAAATTTGGTCATGACCGCTCCACC  384886
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()