YGL042C Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region between ORFs YGL042C and YGL041C-B.
New    418594   ATATACATATACTGCTGGTGTTAATTTTTTTTGTC-TGTCTCACGTAAAATCTTTTGTTC  418652
                ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old    418598   ATATACATATACTGCTGGTGTTAATTTTTTTTGTCCTGTCTCACGTAAAATCTTTTGTTC  418657
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()