YGL041C Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide was deleted within the coding regions of overlapping ORFs YGL041W-A and YGL041C, resulting in altered protein sequences for both ORFs. The YGL041W-A C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 72 amino acids longer. The YGL041C N-terminus remains the same, but the C-terminus has changed and the annotated protein is truncated by one-third of its length (reduced from 104 amino acids to 67 amino acids)
New    419013   ACTCATGGATCAAATAAATTCGAGGCCTAATGTTCTGG-AAAAGTTAGAAAAGGTTAGCA  419071
                |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old    419018   ACTCATGGATCAAATAAATTCGAGGCCTAATGTTCTGGGAAAAGTTAGAAAAGGTTAGCA  419077
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()