YFRCdelta9 Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide deletion was made in the intergenic region between Ty1 LTR YFRCdelta9 and ORF YFR020W.
New    192360  TTTTAGGAATACTGTTGTTCAAGATAGAGCATTTGCATACCTTAT-CGAGGTTCACTATC  192418
               ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    192348  TTTTAGGAATACTGTTGTTCAAGATAGAGCATTTGCATACCTTATCCGAGGTTCACTATC  192407
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()