YFR012W-A Feature History Help

Sequence Annotation Notes
DateNote
2011-02-03A single nucleotide insertion was made in the intergenic region between ORFs YFR012W and YFR012W-A.
New    168840  TTACCTGCAAAGCAAGAAAATGTGGAAATGCCTACTGAAAAAAAAAAGGCAAATATTTTA  168899
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Old    168833  TTACCTGCAAAGCAAGAAAATGTGGAAATGCCTACTG-AAAAAAAAAGGCAAATATTTTA  168891
Engel SR, et al.  (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda) ()